National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6906R-1 
 Symbol CAH2  Full Name Carbonic anhydrase 2 
 CG No CG6906  Old CG No CG6906 
 Synonyms CG6906, CT21171, CAH2 
 Accession No (Link to NCBI) NM_140298.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCGCCCTGGACAAGGATCAC 
 Primer Seq. 3'
aatctagaggtaccGACAATGCAGCGAGGACAACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCTGCCCTG GTACAAGNGN ATCACGGCAT CGCCGTGATG GCCTTCTTCT TTCAGGTGGA 
0061 GCTGACAATA TCAACTGGTG GCTATGAGGG CTTCACCAAC TTGCTCTCCC AGATTGACCG 
0121 CAAAGGCAAG AAGCGTTAAT ATGACCAATC CACTTCCACT GGGTCGAGTA CATCTCGAAG 
0181 TCCGTGGAGC AGATACTTTA GCTACACTGG TTCTCTGACC ACACCGCCTT GCAGTGAGTG 
0241 AGGTCACCTG GCATTGATTT CACAACGCCC ATTGACATCA CGGAGAAGCA GTTGAATGCC 
0301 TTCCGTCTGC TGACAGCCAA CGATGATCAT CTGAAGAACA ATTTCCGACC CATCCAGCCG 
0361 CTGAACGATC GCACCTTGTA CAAGAACTAC ATAGAAATTC CGATTCACAA CATGGGCTCG 
0421 ATTCCACTCG TCGATGCGGA AAATGCGGCT GGCAAGTGGA GGGCACAAGC CGCAGCAGTG 
0481 CTGTTGCCCC TCGTTGTCCT CGCTGCATTG TC 
 in silico PCR Fragment
0001 AGC-GCCCTG G-ACAA--GG ATCACGGCAT CGCCGTGATG GCCTTCTTCT TTCAGGTGG- 
0061 GC-GACAA-A TCAACTGGTG GCTATGAGGG CTTCACCAAC TTGCTCTCCC AGATTGACCG 
0121 CAAAGGCAAG -AGCGTTAAT ATGACCAATC CACTTCCACT GGG-CGAGTA CATCTCGAAG 
0181 TCCGTGGAG- AGTTACTTTA GCTACACTGG TTCTCTGACC ACACCGCCTT GCAGTGAG-G 
0241 AGGTCACCTG G-ATTGATTT CACAACGCCC ATTGACATCA CGGAGAAGCA GTTGAATGCC 
0301 TTCCGTCTGC TGACAGCCAA CGATGATCAT CTGAAGAACA ATTTCCGACC CATCCAGCCG 
0361 CTGAACGATC GCACCTTGTA CAAGAACTAC ATAGAAATTC CGATTCACAA CATGGGCTCG 
0421 ATTCCACTCG TCGATGCGGA AAATGCGGCT GGCAAGTGGA GGGCACAAGC CGCAGCAGTG 
0481 CTGTTGCCCC TCGTTGTCCT CGCTGCATTG TC 
 Assemble Data

6906R-1.IR_full       1   AGCTGCCCTGGTACAAGNGNATCACGGCATCGCCGTGATGGCCTTCTTCTTTCAGGTGGA 60
                          ||| ||||||| ||||  | ||||||||||||||||||||||||||||||||||||||| 
6906R-1.in silico     1   AGC-GCCCTGG-ACAA--GGATCACGGCATCGCCGTGATGGCCTTCTTCTTTCAGGTGG- 60


6906R-1.IR_full       61  GCTGACAATATCAACTGGTGGCTATGAGGGCTTCACCAACTTGCTCTCCCAGATTGACCG 120
                          || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
6906R-1.in silico     61  GC-GACAA-ATCAACTGGTGGCTATGAGGGCTTCACCAACTTGCTCTCCCAGATTGACCG 120


6906R-1.IR_full       121 CAAAGGCAAGAAGCGTTAATATGACCAATCCACTTCCACTGGGTCGAGTACATCTCGAAG 180
                          |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||
6906R-1.in silico     121 CAAAGGCAAG-AGCGTTAATATGACCAATCCACTTCCACTGGG-CGAGTACATCTCGAAG 180


6906R-1.IR_full       181 TCCGTGGAGCAGATACTTTAGCTACACTGGTTCTCTGACCACACCGCCTTGCAGTGAGTG 240
                          ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
6906R-1.in silico     181 TCCGTGGAG-AGTTACTTTAGCTACACTGGTTCTCTGACCACACCGCCTTGCAGTGAG-G 240


6906R-1.IR_full       241 AGGTCACCTGGCATTGATTTCACAACGCCCATTGACATCACGGAGAAGCAGTTGAATGCC 300
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
6906R-1.in silico     241 AGGTCACCTGG-ATTGATTTCACAACGCCCATTGACATCACGGAGAAGCAGTTGAATGCC 300


6906R-1.IR_full       301 TTCCGTCTGCTGACAGCCAACGATGATCATCTGAAGAACAATTTCCGACCCATCCAGCCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6906R-1.in silico     301 TTCCGTCTGCTGACAGCCAACGATGATCATCTGAAGAACAATTTCCGACCCATCCAGCCG 360


6906R-1.IR_full       361 CTGAACGATCGCACCTTGTACAAGAACTACATAGAAATTCCGATTCACAACATGGGCTCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6906R-1.in silico     361 CTGAACGATCGCACCTTGTACAAGAACTACATAGAAATTCCGATTCACAACATGGGCTCG 420


6906R-1.IR_full       421 ATTCCACTCGTCGATGCGGAAAATGCGGCTGGCAAGTGGAGGGCACAAGCCGCAGCAGTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6906R-1.in silico     421 ATTCCACTCGTCGATGCGGAAAATGCGGCTGGCAAGTGGAGGGCACAAGCCGCAGCAGTG 480


6906R-1.IR_full       481 CTGTTGCCCCTCGTTGTCCTCGCTGCATTGTC 512
                          ||||||||||||||||||||||||||||||||
6906R-1.in silico     481 CTGTTGCCCCTCGTTGTCCTCGCTGCATTGTC 512

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140298.2  CG6906-RA (CAH2), mRNA 
0   16  83  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_080175.2  CG12242-RA (GstD5), mRNA 
0   NM_143392.2  CG14521-RA (CG14521), mRNA 
0   NM_142769.2  CG5383-RA (PSR), mRNA 
0   NM_167704.1  CG11710-RA, transcript variant A (CG11710), mRNA 
0   NM_134549.2  CG11710-RB, transcript variant B (CG11710), mRNA 
0   NM_080041.2  CG7935-RA (msk), mRNA 
0   NM_001043067.1  CG33141-RB, transcript variant B (sns), mRNA 
0   NM_176106.1  CG33141-RA, transcript variant A (sns), mRNA 
0   NM_144019.1  CG18672-RA (CG18672), mRNA 
0   NM_132829.2  CG9281-RB, transcript variant B (CG9281), mRNA 
0   NM_167458.2  CG9281-RC, transcript variant C (CG9281), mRNA 
0   NM_139661.2  CG7471-RA (Rpd3), mRNA 
0   NM_078731.2  CG3166-RB, transcript variant B (aop), mRNA 
0   NM_164457.1  CG3166-RA, transcript variant A (aop), mRNA 
0   NM_057620.4  CG9073-RA (TpnC47D), mRNA 
0   NM_001032106.1  CG7100-RL, transcript variant L (CadN), mRNA 
0   NM_001032108.1  CG7100-RJ, transcript variant J (CadN), mRNA 
0   NM_165231.1  CG7100-RE, transcript variant E (CadN), mRNA 
0   NM_165230.1  CG7100-RG, transcript variant G (CadN), mRNA 
0   NM_165229.1  CG7100-RA, transcript variant A (CadN), mRNA 
0   NM_165228.1  CG7100-RC, transcript variant C (CadN), mRNA 
0   NM_165227.1  CG7100-RD, transcript variant D (CadN), mRNA 
0   NM_165226.1  CG7100-RF, transcript variant F (CadN), mRNA 
0   NM_165224.1  CG7100-RH, transcript variant H (CadN), mRNA 
0   NM_001032109.1  CG7100-RI, transcript variant I (CadN), mRNA 
0   NM_001032107.1  CG7100-RK, transcript variant K (CadN), mRNA 
0   NM_165225.1  CG7100-RB, transcript variant B (CadN), mRNA 
0   12  NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.