National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6896R-1 
 Symbol MYPT-75D  Full Name MYPT-75D 
 CG No CG6896  Old CG No CG6896 
 Synonyms CG6896, MYPT-75D 
 Accession No (Link to NCBI) NM_140792.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCAGGAGGATGCCAGCTACA 
 Primer Seq. 3'
aatctagaggtaccATTCGCACCGTACTCCAGCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NCCATGGGAG GATGCCAGCT ACACCAAGCA GCTCAAGATG GAGCACGCCG ATCTGGTGGC 
0061 CGAGATGCAG ACCGTGGAGA GCCTGCCCAC CCACGAGCGA CTCCAGCTGG CCAGACTACG 
0121 TCGTGCGCAG CAGCTGNAAG CTGTCCCGCC AGAAGGACAA GGAGTGGGCC AAGTTGCAGC 
0181 GGGCGAAGGG CNAACACGGC GAGCGGCGGC AGCGGAACCG GATCGCTGGG CAACGGGCTG 
0241 ATGAACGGCA ACGGAGATAC CACGCACCAC TTCCGGTACG CCAATGGTTC GGGCACGTTG 
0301 AGCGGCAGGC GGCACATATC CTTCGAGAAC AGCGTGGTGC TCCTGGAGGC GGCATCCCGG 
0361 AACGACATGC CCGAGGTGGC CGCCCTGCTG CAGCACGGAA TCACGCCGGA TGCCGCAAAC 
0421 GAGGATGGAC TGACGGCGAT GCATCAGGCG TGCATCGATA ACAACGTCGA GATGCTGCAG 
0481 CTGCTGCTGG AGTACGGTGC GAAT 
 in silico PCR Fragment
0001 GCCA--GGAG GATGCCAGCT ACACCAAGCA GCTCAAGATG GAGCACGCCG ATCTGGTGGC 
0061 CGAGATGCAG ACCGTGGAGA GCCTGCCCAC CCACGAGCGA CTCCAGCTGG CCAGACTACG 
0121 TCGTGCGCAG CAGCTG-AAG CTGTCCCGCC AGAAGGACAA GGAGTGGGCC AAGTTGCAGC 
0181 GGGCGAAGGG C-AACACGGC GAGCGGCGGC AGCGGAACCG GATCGCTGGG CAACGGGCTG 
0241 ATGAACGGCA ACGGAGATAC CACGCACCAC TTCCGGCACG CCAATGGTTC GGGCACGTTG 
0301 AGCGGCAGGC GGCACATATC CTTCGAGAAC AGCGTGGTGC TCCTGGAGGC GGCATCCCGG 
0361 AACGACATGC CCGAGGTGGC CGCCCTGCTG CAGCACGGAA TCACGCCGGA TGCCGCAAAC 
0421 GAGGATGGAC TGACGGCGAT GCATCAGGCG TGCATCGATA ACAACGTCGA GATGCTGCAG 
0481 CTGCTGCTGG AGTACGGTGC GAAT 
 Assemble Data

6896R-1.IR_full        1   CCATGGGAGGATGCCAGCTACACCAAGCAGCTCAAGATGGAGCACGCCGATCTGGTGGC 59
                           |||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||
6896R-1.in silico      1   CCA--GGAGGATGCCAGCTACACCAAGCAGCTCAAGATGGAGCACGCCGATCTGGTGGC 59


6896R-1.IR_full       61  CGAGATGCAGACCGTGGAGAGCCTGCCCACCCACGAGCGACTCCAGCTGGCCAGACTACG 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6896R-1.in silico     61  CGAGATGCAGACCGTGGAGAGCCTGCCCACCCACGAGCGACTCCAGCTGGCCAGACTACG 119


6896R-1.IR_full       121 TCGTGCGCAGCAGCTGNAAGCTGTCCCGCCAGAAGGACAAGGAGTGGGCCAAGTTGCAGC 179
                          |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
6896R-1.in silico     121 TCGTGCGCAGCAGCTG-AAGCTGTCCCGCCAGAAGGACAAGGAGTGGGCCAAGTTGCAGC 179


6896R-1.IR_full       181 GGGCGAAGGGCNAACACGGCGAGCGGCGGCAGCGGAACCGGATCGCTGGGCAACGGGCTG 239
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
6896R-1.in silico     181 GGGCGAAGGGC-AACACGGCGAGCGGCGGCAGCGGAACCGGATCGCTGGGCAACGGGCTG 239


6896R-1.IR_full       241 ATGAACGGCAACGGAGATACCACGCACCACTTCCGGTACGCCAATGGTTCGGGCACGTTG 299
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
6896R-1.in silico     241 ATGAACGGCAACGGAGATACCACGCACCACTTCCGGCACGCCAATGGTTCGGGCACGTTG 299


6896R-1.IR_full       301 AGCGGCAGGCGGCACATATCCTTCGAGAACAGCGTGGTGCTCCTGGAGGCGGCATCCCGG 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6896R-1.in silico     301 AGCGGCAGGCGGCACATATCCTTCGAGAACAGCGTGGTGCTCCTGGAGGCGGCATCCCGG 359


6896R-1.IR_full       361 AACGACATGCCCGAGGTGGCCGCCCTGCTGCAGCACGGAATCACGCCGGATGCCGCAAAC 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6896R-1.in silico     361 AACGACATGCCCGAGGTGGCCGCCCTGCTGCAGCACGGAATCACGCCGGATGCCGCAAAC 419


6896R-1.IR_full       421 GAGGATGGACTGACGGCGATGCATCAGGCGTGCATCGATAACAACGTCGAGATGCTGCAG 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6896R-1.in silico     421 GAGGATGGACTGACGGCGATGCATCAGGCGTGCATCGATAACAACGTCGAGATGCTGCAG 479


6896R-1.IR_full       481 CTGCTGCTGGAGTACGGTGCGAAT 503
                          ||||||||||||||||||||||||
6896R-1.in silico     481 CTGCTGCTGGAGTACGGTGCGAAT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  45  NM_140792.1  CG6896-RA (MYPT-75D), mRNA 
0.2   37  NM_206622.2  CG32776-RB, transcript variant B (CG32776), mRNA 
0.2   37  NM_001038740.1  CG32776-RD, transcript variant D (CG32776), mRNA 
0.2   NM_141658.3  CG8301-RA (CG8301), mRNA 
0   17  74  NM_132246.2  CG10555-RA (CG10555), mRNA 
0   17  53  NM_132235.2  CG32717-RB, transcript variant B (sdt), mRNA 
0   12  25  NM_001038747.1  CG32717-RF, transcript variant F (sdt), mRNA 
0   42  NM_206653.1  CG32717-RE, transcript variant E (sdt), mRNA 
0   42  NM_132236.3  CG32717-RA, transcript variant A (sdt), mRNA 
0   20  NM_132115.1  CG14440-RA (CG14440), mRNA 
0   20  NM_057385.4  CG11121-RA (so), mRNA 
0   NM_134768.3  CG17660-RA (CG17660), mRNA 
0   17  63  NM_057678.3  CG31240-RA (repo), mRNA 
0   13  37  NM_001032408.1  CG33956-RD, transcript variant D (kay), mRNA 
0   11  22  NM_136910.1  CG13165-RA (CG13165), mRNA 
0   51  NM_143409.1  CG11873-RA (CG11873), mRNA 
0   59  NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   35  NM_206514.1  CG14307-RK, transcript variant K (fru), mRNA 
0   35  NM_169818.1  CG14307-RH, transcript variant H (fru), mRNA 
0   35  NM_169817.1  CG14307-RG, transcript variant G (fru), mRNA 
0   30  NM_168361.1  CG16711-RB, transcript variant B (CG16711), mRNA 
0   30  NM_140090.1  CG16711-RA, transcript variant A (CG16711), mRNA 
0   NM_132504.1  CG11695-RA (CG11695), mRNA 
0   14  NM_001042798.1  CG32717-RH, transcript variant H (sdt), mRNA 
0   26  64  NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
0   26  64  NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
0   21  86  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   21  86  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   18  64  NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
0   18  64  NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.