National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6876R-1 
 Symbol CG6876  Full Name CG6876 
 CG No CG6876  Old CG No CG6876 
 Synonyms clone 2.38, anon-EST:Liang-2.38, CG6876 
 Accession No (Link to NCBI) NM_140499.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ray P, Luo X, Rao EJ, Basha A, Woodruff EA 3rd, Wu JY.
The splicing factor Prp31 is essential for photoreceptor development in Drosophila.
Protein Cell (2010) 1(3) 267-74 [ PubMed ID = 21203973 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTTTTAGCCGATCTCGAGGA 
 Primer Seq. 3'
aatctagaggtaccTAATGGTGGCCTGCGTGAGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTATTTAGC CGATGCTCGA GGAAGACAAT GACAATGAGC TGGAGGAGGA GGATTCGGAG 
0061 ATGGCCAGTG CAGAGGACGA GAGCTTGCTG GCGGAGAAGC TGGCTAAGCC GGCTCCCAAT 
0121 CTGATGGACG TGGATGTAAC CGTGCAGTCG GTGCGGGAAC TGTGCAAGCT GCGCGACTCT 
0181 GAGCGCCTGA AGAACACGCT GCAGCAGATC GAGCACTATG CCAGTCGCCA GAGAACTGCA 
0241 GCCGAAATGC TGGGATCCGT AGAATCCGAT CCAGAGTACT GCCTCATCGT GGACGCGAAT 
0301 GCCATAGCCG TGGACATTGA CAACGAGATC TCCATTGTGC ACAAGTTCAC CAAGGAGAAG 
0361 TATCAGAAGC GATTCCCCGA ATTGGACTCC CTGATCGTGG GTGAAATCGA GTACTTGCTG 
0421 GCGGTCAAGG AGCTGGGCAA CGACCTGGAC CAGGTCAAAA ATAACGAGAA GCTGCAGGCT 
0481 ATTCTCACGC AGGCCACCAT TA 
 in silico PCR Fragment
0001 GCT-TTTAGC CGAT-CTCGA GGAAGACAAT GACAATGAGC TGGAGGAGGA GGATTCGGAG 
0061 ATGGCCAGTG CAGAGGACGA GAGCTTGCTG GCGGAGAAGC TGGCTAAGCC GGCTCCCAAT 
0121 CTGATGGACG TGGATGTAAC CGTGCAGTCG GTGCGGGAAC TGTGCAAGCT GCGCGACTCT 
0181 GAGCGCCTGA AGAACACGCT GCAGCAGATC GAGCACTATG CCAGTCGCCA GAGAACTGCA 
0241 GCCGAAATGC TGGGATCCGT AGAATCCGAT CCAGAGTACT GCCTCATCGT GGACGCTAAT 
0301 GCCATAGCTG TGGACATTGA CAACGAGATC TCCATTGTGC ACAAGTTCAC CAAGGAGAAG 
0361 TATCAGAAGC GATTCCCCGA ATTGGACTCC CTGATCGTGG GTGAAATCGA GTACTTGCTG 
0421 GCGGTCAAGG AGCTGGGCAA CGACCTGGAC CAGGTCAAAA ATAACGAGAA GCTGCAGGCT 
0481 ATTCTCACGC AGGCCACCAT TA 
 Assemble Data

6876R-1.IR_full       1   GCTATTTAGCCGATGCTCGAGGAAGACAATGACAATGAGCTGGAGGAGGAGGATTCGGAG 60
                          ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||
6876R-1.in silico     1   GCT-TTTAGCCGAT-CTCGAGGAAGACAATGACAATGAGCTGGAGGAGGAGGATTCGGAG 60


6876R-1.IR_full       61  ATGGCCAGTGCAGAGGACGAGAGCTTGCTGGCGGAGAAGCTGGCTAAGCCGGCTCCCAAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6876R-1.in silico     61  ATGGCCAGTGCAGAGGACGAGAGCTTGCTGGCGGAGAAGCTGGCTAAGCCGGCTCCCAAT 120


6876R-1.IR_full       121 CTGATGGACGTGGATGTAACCGTGCAGTCGGTGCGGGAACTGTGCAAGCTGCGCGACTCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6876R-1.in silico     121 CTGATGGACGTGGATGTAACCGTGCAGTCGGTGCGGGAACTGTGCAAGCTGCGCGACTCT 180


6876R-1.IR_full       181 GAGCGCCTGAAGAACACGCTGCAGCAGATCGAGCACTATGCCAGTCGCCAGAGAACTGCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6876R-1.in silico     181 GAGCGCCTGAAGAACACGCTGCAGCAGATCGAGCACTATGCCAGTCGCCAGAGAACTGCA 240


6876R-1.IR_full       241 GCCGAAATGCTGGGATCCGTAGAATCCGATCCAGAGTACTGCCTCATCGTGGACGCGAAT 300
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
6876R-1.in silico     241 GCCGAAATGCTGGGATCCGTAGAATCCGATCCAGAGTACTGCCTCATCGTGGACGCTAAT 300


6876R-1.IR_full       301 GCCATAGCCGTGGACATTGACAACGAGATCTCCATTGTGCACAAGTTCACCAAGGAGAAG 360
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
6876R-1.in silico     301 GCCATAGCTGTGGACATTGACAACGAGATCTCCATTGTGCACAAGTTCACCAAGGAGAAG 360


6876R-1.IR_full       361 TATCAGAAGCGATTCCCCGAATTGGACTCCCTGATCGTGGGTGAAATCGAGTACTTGCTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6876R-1.in silico     361 TATCAGAAGCGATTCCCCGAATTGGACTCCCTGATCGTGGGTGAAATCGAGTACTTGCTG 420


6876R-1.IR_full       421 GCGGTCAAGGAGCTGGGCAACGACCTGGACCAGGTCAAAAATAACGAGAAGCTGCAGGCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6876R-1.in silico     421 GCGGTCAAGGAGCTGGGCAACGACCTGGACCAGGTCAAAAATAACGAGAAGCTGCAGGCT 480


6876R-1.IR_full       481 ATTCTCACGCAGGCCACCATTA 502
                          ||||||||||||||||||||||
6876R-1.in silico     481 ATTCTCACGCAGGCCACCATTA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140499.2  CG6876-RA (CG6876), mRNA 
0.2   14  23  NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 
0   NM_057273.3  CG2043-RA (Lcp3), mRNA 
0   NM_137946.2  CG10315-RA, transcript variant A (eIF2B-delta), mRNA 
0   NM_166602.1  CG10315-RC, transcript variant C (eIF2B-delta), mRNA 
0   NM_166601.1  CG10315-RB, transcript variant B (eIF2B-delta), mRNA 
0   NM_057274.3  CG2044-RA (Lcp4), mRNA 
0   NM_135773.2  CG5705-RA (CG5705), mRNA 
0   NM_136784.3  CG12942-RA (CG12942), mRNA 
0   NM_176176.1  CG8183-RB, transcript variant B (Khc-73), mRNA 
0   NM_135357.3  CG8183-RA, transcript variant A (Khc-73), mRNA 
0   NM_166075.1  CG30475-RA (CG30475), mRNA 
0   NM_165970.1  CG4062-RB, transcript variant B (Aats-val), mRNA 
0   NM_080099.2  CG4062-RA, transcript variant A (Aats-val), mRNA 
0   NM_135679.3  CG14935-RA, transcript variant A (CG14935), mRNA 
0   NM_164975.2  CG14935-RB, transcript variant B (CG14935), mRNA 
0   NM_140370.1  CG11274-RA (SRm160), mRNA 
0   NM_140654.1  CG13032-RA (CG13032), mRNA 
0   NM_136418.2  CG11060-RA (CG11060), mRNA 
0   NM_137256.1  CG15701-RA (CG15701), mRNA 
0   NM_130602.2  CG3480-RA (mip130), mRNA 
0   NM_141642.1  CG9373-RA (CG9373), mRNA 
0   13  NM_140803.1  CG14073-RB, transcript variant B (CG14073), mRNA 
0   NM_132375.1  CG2972-RA (CG2972), mRNA 
0   NM_141574.2  CG13318-RA (CG13318), mRNA 
0   11  NM_136675.1  CG1625-RA (CG1625), mRNA 
0   NM_132521.2  CG1578-RA (CG1578), mRNA 
0   NM_142674.2  CG10827-RA (CG10827), mRNA 
0   13  NM_167298.1  CG2446-RA, transcript variant A (CG2446), mRNA 
0   13  NM_167300.1  CG2446-RD, transcript variant D (CG2446), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.