National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6876R-1 
 Symbol CG6876  Full Name CG6876 
 CG No CG6876  Old CG No CG6876 
 Synonyms clone 2.38, anon-EST:Liang-2.38, CG6876 
 Accession No (Link to NCBI) NM_140499.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ray P, Luo X, Rao EJ, Basha A, Woodruff EA 3rd, Wu JY.
The splicing factor Prp31 is essential for photoreceptor development in Drosophila.
Protein Cell (2010) 1(3) 267-74 [ PubMed ID = 21203973 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCT-TTTAGCCGAT-CTCGAGGAAGACAATGACAATGAGCTGGAGGAGGAGGATTCGGAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATGGCCAGTGCAGAGGACGAGAGCTTGCTGGCGGAGAAGCTGGCTAAGCCGGCTCCCAAT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CTGATGGACGTGGATGTAACCGTGCAGTCGGTGCGGGAACTGTGCAAGCTGCGCGACTCT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGCGCCTGAAGAACACGCTGCAGCAGATCGAGCACTATGCCAGTCGCCAGAGAACTGCA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     241 GCCGAAATGCTGGGATCCGTAGAATCCGATCCAGAGTACTGCCTCATCGTGGACGCTAAT 300

                          |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCCATAGCTGTGGACATTGACAACGAGATCTCCATTGTGCACAAGTTCACCAAGGAGAAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TATCAGAAGCGATTCCCCGAATTGGACTCCCTGATCGTGGGTGAAATCGAGTACTTGCTG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCGGTCAAGGAGCTGGGCAACGACCTGGACCAGGTCAAAAATAACGAGAAGCTGCAGGCT 480

6876R-1.IR_full       481 ATTCTCACGCAGGCCACCATTA 502
                          |||||||||||||||||||||| silico     481 ATTCTCACGCAGGCCACCATTA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140499.2  CG6876-RA (CG6876), mRNA 
0.2   14  23  NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 
0   NM_057273.3  CG2043-RA (Lcp3), mRNA 
0   NM_137946.2  CG10315-RA, transcript variant A (eIF2B-delta), mRNA 
0   NM_166602.1  CG10315-RC, transcript variant C (eIF2B-delta), mRNA 
0   NM_166601.1  CG10315-RB, transcript variant B (eIF2B-delta), mRNA 
0   NM_057274.3  CG2044-RA (Lcp4), mRNA 
0   NM_135773.2  CG5705-RA (CG5705), mRNA 
0   NM_136784.3  CG12942-RA (CG12942), mRNA 
0   NM_176176.1  CG8183-RB, transcript variant B (Khc-73), mRNA 
0   NM_135357.3  CG8183-RA, transcript variant A (Khc-73), mRNA 
0   NM_166075.1  CG30475-RA (CG30475), mRNA 
0   NM_165970.1  CG4062-RB, transcript variant B (Aats-val), mRNA 
0   NM_080099.2  CG4062-RA, transcript variant A (Aats-val), mRNA 
0   NM_135679.3  CG14935-RA, transcript variant A (CG14935), mRNA 
0   NM_164975.2  CG14935-RB, transcript variant B (CG14935), mRNA 
0   NM_140370.1  CG11274-RA (SRm160), mRNA 
0   NM_140654.1  CG13032-RA (CG13032), mRNA 
0   NM_136418.2  CG11060-RA (CG11060), mRNA 
0   NM_137256.1  CG15701-RA (CG15701), mRNA 
0   NM_130602.2  CG3480-RA (mip130), mRNA 
0   NM_141642.1  CG9373-RA (CG9373), mRNA 
0   13  NM_140803.1  CG14073-RB, transcript variant B (CG14073), mRNA 
0   NM_132375.1  CG2972-RA (CG2972), mRNA 
0   NM_141574.2  CG13318-RA (CG13318), mRNA 
0   11  NM_136675.1  CG1625-RA (CG1625), mRNA 
0   NM_132521.2  CG1578-RA (CG1578), mRNA 
0   NM_142674.2  CG10827-RA (CG10827), mRNA 
0   13  NM_167298.1  CG2446-RA, transcript variant A (CG2446), mRNA 
0   13  NM_167300.1  CG2446-RD, transcript variant D (CG2446), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.