National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6767R-2 
 Symbol CG6767  Full Name CG6767 
 CG No CG6767  Old CG No CG6767 
 Synonyms CG6767 
 Accession No (Link to NCBI) NM_140088.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGATCTCGGCAAGGTGGTTA 
 Primer Seq. 3'
aatctagaggtaccCAGAGCGAACTCCACGTTCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGATCTCGG CAAGGTGGTT ACGAAGAAGT TCAGCAACTT GGAGACCTGT GTGGAAATTG 
0061 GGGAATCGGT GCGCGGCGAG GATGTGTACA TCGTGCAATC GGGATCCGGC GAGATCAACG 
0121 ATAACTTGAT GGAGCTGCTG ATCATGATCA ATGCGTGCAA AATTGCCTCA GCCTCTCGTG 
0181 TTACAGCTGT GATTCCTTGC TTTCCATATG CCCGCCAAGA TAAAAAAGAC AAGAGTCGTG 
0241 CGCCCATCTC GGCCAAATTG GTGGCCAACA TGCTGTCCGT TGCTGGAGCG GATCACATCA 
0301 TCACCATGGA TCTGCACGCC TCACAGATTC AGGGCTTCTT TGATATACCA GTTGATAATC 
0361 TCTNATGcCG AGCCGGCGGT ACTCAAGTGG ATCAAGGAGA ACATTCCCGA GTGGAAGAAC 
0421 TCGATCATTG TGTCGCCCGA TGCTgGCGGT GCCAAGCGTG TCACCTCAAT TGCCGATCGA 
0481 CTGAACGTGG AGTTCGCTCT G 
 in silico PCR Fragment
0001 TCGATCTCGG CAAGGTGGTT ACGAAGAAGT TCAGCAACTT GGAGACCTGT GTGGAAATTG 
0061 GGGAATCGGT GCGCGGCGAG GATGTGTACA TCGTGCAATC GGGATCCGGC GAGATCAACG 
0121 ATAACTTGAT GGAGCTGCTG ATCATGATCA ATGCGTGCAA AATTGCCTCA GCCTCTCGTG 
0181 TTACAGCTGT GATTCCTTGC TTTCCATATG CCCGCCAAGA TAAAAAAGAC AAGAGTCGTG 
0241 CGCCCATCTC GGCCAAATTG GTGGCCAACA TGCTGTCCGT TGCTGGAGCG GATCACATCA 
0301 TCACCATGGA TCTGCACGCC TCACAGATTC AGGGCTTCTT TGATATACCA GTTGATAATC 
0361 TCT-ATGCCG AGCCGGCGGT ACTCAAGTGG ATCAAGGAGA ACATTCCCGA GTGGAAGAAC 
0421 TCGATCATTG TGTCGCCCGA TGCTGGCGGT GCCAAGCGTG TCACCTCAAT TGCCGATCGA 
0481 CTGAACGTGG AGTTCGCTCT G 
 Assemble Data

6767R-2.IR_full       1   TCGATCTCGGCAAGGTGGTTACGAAGAAGTTCAGCAACTTGGAGACCTGTGTGGAAATTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6767R-2.in silico     1   TCGATCTCGGCAAGGTGGTTACGAAGAAGTTCAGCAACTTGGAGACCTGTGTGGAAATTG 60


6767R-2.IR_full       61  GGGAATCGGTGCGCGGCGAGGATGTGTACATCGTGCAATCGGGATCCGGCGAGATCAACG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6767R-2.in silico     61  GGGAATCGGTGCGCGGCGAGGATGTGTACATCGTGCAATCGGGATCCGGCGAGATCAACG 120


6767R-2.IR_full       121 ATAACTTGATGGAGCTGCTGATCATGATCAATGCGTGCAAAATTGCCTCAGCCTCTCGTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6767R-2.in silico     121 ATAACTTGATGGAGCTGCTGATCATGATCAATGCGTGCAAAATTGCCTCAGCCTCTCGTG 180


6767R-2.IR_full       181 TTACAGCTGTGATTCCTTGCTTTCCATATGCCCGCCAAGATAAAAAAGACAAGAGTCGTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6767R-2.in silico     181 TTACAGCTGTGATTCCTTGCTTTCCATATGCCCGCCAAGATAAAAAAGACAAGAGTCGTG 240


6767R-2.IR_full       241 CGCCCATCTCGGCCAAATTGGTGGCCAACATGCTGTCCGTTGCTGGAGCGGATCACATCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6767R-2.in silico     241 CGCCCATCTCGGCCAAATTGGTGGCCAACATGCTGTCCGTTGCTGGAGCGGATCACATCA 300


6767R-2.IR_full       301 TCACCATGGATCTGCACGCCTCACAGATTCAGGGCTTCTTTGATATACCAGTTGATAATC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6767R-2.in silico     301 TCACCATGGATCTGCACGCCTCACAGATTCAGGGCTTCTTTGATATACCAGTTGATAATC 360


6767R-2.IR_full       361 TCTNATGCCGAGCCGGCGGTACTCAAGTGGATCAAGGAGAACATTCCCGAGTGGAAGAAC 420
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6767R-2.in silico     361 TCT-ATGCCGAGCCGGCGGTACTCAAGTGGATCAAGGAGAACATTCCCGAGTGGAAGAAC 420


6767R-2.IR_full       421 TCGATCATTGTGTCGCCCGATGCTGGCGGTGCCAAGCGTGTCACCTCAATTGCCGATCGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6767R-2.in silico     421 TCGATCATTGTGTCGCCCGATGCTGGCGGTGCCAAGCGTGTCACCTCAATTGCCGATCGA 480


6767R-2.IR_full       481 CTGAACGTGGAGTTCGCTCTG 501
                          |||||||||||||||||||||
6767R-2.in silico     481 CTGAACGTGGAGTTCGCTCTG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   551  NM_168360.1  CG6767-RB, transcript variant B (CG6767), mRNA 
84.39   465  NM_140088.2  CG6767-RA, transcript variant A (CG6767), mRNA 
0   10  NM_170510.1  CG2246-RA, transcript variant A (CG2246), mRNA 
0   10  NM_170511.1  CG2246-RC, transcript variant C (CG2246), mRNA 
0   10  NM_170507.1  CG2246-RB, transcript variant B (CG2246), mRNA 
0   10  NM_170508.1  CG2246-RD, transcript variant D (CG2246), mRNA 
0   10  NM_170509.1  CG2246-RF, transcript variant F (CG2246), mRNA 
0   10  NM_143556.2  CG2246-RE, transcript variant E (CG2246), mRNA 
0   NM_135962.1  CG17905-RA (CG17905), mRNA 
0   NM_132185.1  CG15325-RA (CG15325), mRNA 
0   NM_078745.2  CG12676-RA (ed), mRNA 
0   NM_080148.2  CG2522-RA (Gtp-bp), mRNA 
0   NM_135386.3  CG13401-RA, transcript variant A (U26), mRNA 
0   NM_205938.1  CG13401-RB, transcript variant B (U26), mRNA 
0   NM_132206.1  CG2253-RA (Upf2), mRNA 
0   NM_079545.2  CG1031-RA (alpha-Est1), mRNA 
0   NM_132917.1  CG13010-RA (CG13010), mRNA 
0   NM_164371.1  CG11455-RA, transcript variant A (CG11455), mRNA 
0   NM_164372.1  CG11455-RB, transcript variant B (CG11455), mRNA 
0   NM_134664.1  CG17075-RA (CG17075), mRNA 
0   NM_132225.1  CG18262-RA (CG18262), mRNA 
0   NM_132056.3  CG4790-RA (fs(1)M3), mRNA 
0   19  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_136595.1  CG13744-RA (CG13744), mRNA 
0   NM_132151.1  CG14427-RA (CG14427), mRNA 
0   NM_142312.1  CG14905-RA (CG14905), mRNA 
0   NM_078535.2  CG1634-RA, transcript variant A (Nrg), mRNA 
0   NM_167160.1  CG1634-RB, transcript variant B (Nrg), mRNA 
0   NM_206657.1  CG1634-RC, transcript variant C (Nrg), mRNA 
0   NM_078772.2  CG13772-RA (neuroligin), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.