National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6761R-1 
 Symbol CG6761  Full Name CG6761 
 CG No CG6761  Old CG No CG6761 
 Synonyms CG6761 
 Accession No (Link to NCBI) NM_140089.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGACATGGGAAAACCACACAA 
 Primer Seq. 3'
aatctagaggtaccATTTCGATGCTCCCGAGGTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGACATGGGA AAACCACACA ATAGGGAGCC GATACCGCCG ATGGAGGGCA GTGCGGTGTC 
0061 AACCAAGAGA GCTACCAAGA AGGACGAGTT CGACTTTGCC GAACTGGCGG ACAATCCACT 
0121 GGTCAACGAG CTCCTGGGAC TGCGACGACC CTCGAGGAGC TCCAACGAGA GTCGCTCTAG 
0181 TTTGCTACAG GATGCGAAAT CCAGTACATT GCGCTCGGGG CACAGCCACC ACGGCCGCTC 
0241 TTCCCGTCCA GAGTCGACCT ATCGGGGATT GCATCCCAAG CTTGGCGANG CAACTGGATG 
0301 CGGCCATTAA TGAGGGAGTT CTGGACTCTG TTCTGTCCTT TATATGCCCG GTCCCAATGC 
0361 CCACACAACT CCAGAATGGC AAAACTAAGC CCAAGCAGCT GCAGCCTCCG AAAGAGCTTC 
0421 TCACCCAGAC ATCGGCCACT ACCACTCCCT ATACGAATCC CATTCCAGCG GCAGCTCCTC 
0481 TCACCTCGGG AGCATCGAAA T 
 in silico PCR Fragment
0001 CGACATGGGA AAACCACACA ATAGGGAGCC GATACCGCCG ATGGAGGGCA GTGCGGTGTC 
0061 AACCAAGAGA GCTACCAAGA AGGACGAGTT CGACTTTGCC GAACTGGCGG ACAATCCACT 
0121 GGTCAACGAG CTCCTGGGAC TGCGACGACC CTCGAGGAGC TCCAACGAGA GTCGCTCTAG 
0181 TTTGCTACAG GATGCGAAAT CCAGTACATT GCGCTCGGGG CACAGCCACC ACGGCCGCTC 
0241 TTCCCGTCCA GAGTCGACCT ATCGGGGATT GCATCCCAAG CTTGGCGA-G CAACTGGATG 
0301 CGGCCATTAA TGAGGGAGTT CTGGACTCTG TTCTGTCCTT TATATGCCCG GTCCCAATGC 
0361 CCACACAACT CCAGAATGGC AAAACTAAGC CCAAGCAGCT GCAGCCTCCG AAAGAGCTTC 
0421 TCACCCAGAC ATCGGCCACT ACCACTCCCT ATACGAATCC CATTCCAGCG GCAGCTCCTC 
0481 TCACCTCGGG AGCATCGAAA T 
 Assemble Data

6761R-1.IR_full       1   CGACATGGGAAAACCACACAATAGGGAGCCGATACCGCCGATGGAGGGCAGTGCGGTGTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6761R-1.in silico     1   CGACATGGGAAAACCACACAATAGGGAGCCGATACCGCCGATGGAGGGCAGTGCGGTGTC 60


6761R-1.IR_full       61  AACCAAGAGAGCTACCAAGAAGGACGAGTTCGACTTTGCCGAACTGGCGGACAATCCACT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6761R-1.in silico     61  AACCAAGAGAGCTACCAAGAAGGACGAGTTCGACTTTGCCGAACTGGCGGACAATCCACT 120


6761R-1.IR_full       121 GGTCAACGAGCTCCTGGGACTGCGACGACCCTCGAGGAGCTCCAACGAGAGTCGCTCTAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6761R-1.in silico     121 GGTCAACGAGCTCCTGGGACTGCGACGACCCTCGAGGAGCTCCAACGAGAGTCGCTCTAG 180


6761R-1.IR_full       181 TTTGCTACAGGATGCGAAATCCAGTACATTGCGCTCGGGGCACAGCCACCACGGCCGCTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6761R-1.in silico     181 TTTGCTACAGGATGCGAAATCCAGTACATTGCGCTCGGGGCACAGCCACCACGGCCGCTC 240


6761R-1.IR_full       241 TTCCCGTCCAGAGTCGACCTATCGGGGATTGCATCCCAAGCTTGGCGANGCAACTGGATG 300
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
6761R-1.in silico     241 TTCCCGTCCAGAGTCGACCTATCGGGGATTGCATCCCAAGCTTGGCGA-GCAACTGGATG 300


6761R-1.IR_full       301 CGGCCATTAATGAGGGAGTTCTGGACTCTGTTCTGTCCTTTATATGCCCGGTCCCAATGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6761R-1.in silico     301 CGGCCATTAATGAGGGAGTTCTGGACTCTGTTCTGTCCTTTATATGCCCGGTCCCAATGC 360


6761R-1.IR_full       361 CCACACAACTCCAGAATGGCAAAACTAAGCCCAAGCAGCTGCAGCCTCCGAAAGAGCTTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6761R-1.in silico     361 CCACACAACTCCAGAATGGCAAAACTAAGCCCAAGCAGCTGCAGCCTCCGAAAGAGCTTC 420


6761R-1.IR_full       421 TCACCCAGACATCGGCCACTACCACTCCCTATACGAATCCCATTCCAGCGGCAGCTCCTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6761R-1.in silico     421 TCACCCAGACATCGGCCACTACCACTCCCTATACGAATCCCATTCCAGCGGCAGCTCCTC 480


6761R-1.IR_full       481 TCACCTCGGGAGCATCGAAAT 501
                          |||||||||||||||||||||
6761R-1.in silico     481 TCACCTCGGGAGCATCGAAAT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140089.1  CG6761-RA (CG6761), mRNA 
0   NM_132791.2  CG12608-RA (CG12608), mRNA 
0   NM_080380.1  CG4326-RA (mRpS17), mRNA 
0   NM_136154.1  CG10631-RA (CG10631), mRNA 
0   NM_132790.1  CG9123-RA (CG9123), mRNA 
0   NM_080330.2  CG3620-RA, transcript variant A (norpA), mRNA 
0   NM_001014721.1  CG3620-RC, transcript variant C (norpA), mRNA 
0   NM_167008.1  CG3620-RB, transcript variant B (norpA), mRNA 
0   NM_001014720.1  CG3620-RD, transcript variant D (norpA), mRNA 
0   NM_167973.1  CG1271-RD, transcript variant D (CG1271), mRNA 
0   NM_139506.2  CG1271-RA, transcript variant A (CG1271), mRNA 
0   NM_167974.1  CG1271-RB, transcript variant B (CG1271), mRNA 
0   NM_206259.1  CG1271-RC, transcript variant C (CG1271), mRNA 
0   NM_140580.1  CG5414-RA (CG5414), mRNA 
0   NM_078779.2  CG5125-RB, transcript variant B (ninaC), mRNA 
0   NM_132608.2  CG32649-RA (CG32649), mRNA 
0   NM_137229.2  CG8370-RA (CG8370), mRNA 
0   NM_164747.1  CG5125-RA, transcript variant A (ninaC), mRNA 
0   NM_057912.3  CG5201-RA, transcript variant A (Dad), mRNA 
0   NM_001014629.1  CG5201-RC, transcript variant C (Dad), mRNA 
0   NM_169740.1  CG5201-RB, transcript variant B (Dad), mRNA 
0   NM_139852.2  CG8591-RA (CTCF), mRNA 
0   NM_132660.2  CG1716-RA (CG1716), mRNA 
0   NM_165270.1  CG31792-RA (CG31792), mRNA 
0   NM_142914.2  CG10252-RA (CG10252), mRNA 
0   NM_143457.1  CG15506-RA, transcript variant A (CG15506), mRNA 
0   NM_170421.1  CG15506-RB, transcript variant B (CG15506), mRNA 
0   NM_143414.2  CG11881-RA (CG11881), mRNA 
0   NM_080765.2  CG13777-RC, transcript variant C (milt), mRNA 
0   NM_169545.1  CG9374-RF, transcript variant F (lkb1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.