National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6736R-3 
 Symbol Ilp4  Full Name insulin-like peptide 4 
 CG No CG6736  Old CG No CG6736 
 Synonyms mes3, CG6736, dilp4, dilp, Mes3, anon-EST:CLB3, dilp-4, DILP, Dilp, Dilp 4, Dirlp, DILP4, unnamed, A, BcDNA:RE27042, Ilp4 
 Accession No (Link to NCBI) NM_140104.2 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GATTAGACTGG-GACTGGCGCTGCTGCTCCTGCTGGCCACCGTGTCGCAGTTACTGCAGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGGTCCAGGGACGCCGAAAGATGTGCGGCGAGGCTCTGATCCAGGCACTGGATGTGATTT 120

                          ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| silico     121 GTGTTAATGGATTTACACGCCGTGTCAGGCGGAGCAGTGCGTC-TAAGGATGCTAGAGTG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CGAGACCTTATCCGTAAGCTACAGCAGCCGGATGAGGACATTGAACAGGAAACGGAAACG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGAAGGTTAAAGCAGAAGCATACGGATGCGGATACGGAGAAGGGTGTGCCACCGGCCGTC 300

                          |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| silico     301 GGAAGTGGACGAAAGTTGCGACGCCATCGGCGACGCATCGCCCACGAGTGTTGCAAGGAG 360

                          ||||||||||||||||||||||||||||| |||||| silico     361 GGCTGCACCTACGACGATATACTGGACTA-CTGCGC 396

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   375  NM_140104.2  CG6736-RA (Ilp4), mRNA 
0.26   NM_132483.2  CG1737-RA (CG1737), mRNA 
0.26   NM_141002.1  CG11451-RA (CG11451), mRNA 
0   NM_080319.3  CG4125-RA (rst), mRNA 
0   10  NM_079713.2  CG6376-RA, transcript variant A (E2f), mRNA 
0   10  NM_169962.1  CG6376-RC, transcript variant C (E2f), mRNA 
0   10  NM_169961.1  CG6376-RB, transcript variant B (E2f), mRNA 
0   16  NM_132116.1  CG14441-RA (CG14441), mRNA 
0   NM_079720.2  CG6455-RA, transcript variant A (CG6455), mRNA 
0   NM_169988.1  CG6455-RB, transcript variant B (CG6455), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   11  NM_142844.1  CG7031-RA (CG7031), mRNA 
0   10  NM_164715.1  CG32828-RA (CG32828), mRNA 
0   NM_143582.1  CG15552-RA (Sox100B), mRNA 
0   NM_143025.1  CG13632-RA (CG13632), mRNA 
0   10  23  NM_132595.1  CG15725-RA (CG15725), mRNA 
0   36  NM_167330.2  CG17762-RD, transcript variant D (tomosyn), mRNA 
0   56  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_079105.2  CG4084-RA (l(2)not), mRNA 
0   19  NM_132779.1  CG15028-RB, transcript variant B (CG15028), mRNA 
0   NM_141884.3  CG14734-RA (Tk), mRNA 
0   14  NM_167320.1  CG32655-RA (CG32655), mRNA 
0   NM_139863.3  CG8560-RA (CG8560), mRNA 
0   39  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
0   14  NM_167431.1  CG15028-RA, transcript variant A (CG15028), mRNA 
0   11  NM_139786.1  CG13300-RA (CG13300), mRNA 
0   NM_079997.2  CG13580-RA (Crtp), mRNA 
0   NM_130694.2  CG14265-RB (CG14265), mRNA 
0   NM_132298.3  CG7039-RA (CG7039), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.