National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6736R-2 
 Symbol Ilp4  Full Name insulin-like peptide 4 
 CG No CG6736  Old CG No CG6736 
 Synonyms mes3, CG6736, dilp4, dilp, Mes3, anon-EST:CLB3, dilp-4, DILP, Dilp, Dilp 4, Dirlp, DILP4, unnamed, A, BcDNA:RE27042, Ilp4 
 Accession No (Link to NCBI) NM_140104.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATTAGACTGGGACTGGCGCT 
 Primer Seq. 3'
aatctagaggtaccGCGCAGTAGTCCAGTATATCG 
 Predicted Fragment Size
393 
 IR fragment full Seq
0001 GATTAGACTG GNGACTGGCG CTGCTGCTCC TGCTGGCCAC CGTGTCGCAG TTACTGCAGC 
0061 CGGTCCAGGG ACGCCGAAAG ATGTGCGGCG AGGCTCTGAT CCAGGCACTG GATGTGATTT 
0121 GTGTTAATGG ATTTACACGC CGTGTCAGGC GGAGCAGTGC GTCNTAAGGA TGCTAGAGTG 
0181 CGAGACCTTA TCCGTAAGCT ACAGCAGCCG GATGAGGACA TTGAACAGGA AACGGAAACG 
0241 GGAAGGTTAA AGCAGAAGCA TACGGATGCG GATACGGAGA AGGGTGTGCC ACCGGCCGTC 
0301 GGAAGTGGAC GAAAGTTGCG ACgCCATCgG NGACGCATCG CCCACGAGTG TTGCAAGGAG 
0361 GGCTGCACCT ACGACGATAT ACTGGACTAN CTGCGC 
 in silico PCR Fragment
0001 GATTAGACTG G-GACTGGCG CTGCTGCTCC TGCTGGCCAC CGTGTCGCAG TTACTGCAGC 
0061 CGGTCCAGGG ACGCCGAAAG ATGTGCGGCG AGGCTCTGAT CCAGGCACTG GATGTGATTT 
0121 GTGTTAATGG ATTTACACGC CGTGTCAGGC GGAGCAGTGC GTC-TAAGGA TGCTAGAGTG 
0181 CGAGACCTTA TCCGTAAGCT ACAGCAGCCG GATGAGGACA TTGAACAGGA AACGGAAACG 
0241 GGAAGGTTAA AGCAGAAGCA TACGGATGCG GATACGGAGA AGGGTGTGCC ACCGGCCGTC 
0301 GGAAGTGGAC GAAAGTTGCG ACGCCATCGG CGACGCATCG CCCACGAGTG TTGCAAGGAG 
0361 GGCTGCACCT ACGACGATAT ACTGGACTA- CTGCGC 
 Assemble Data

6736R-2.IR_full       1   GATTAGACTGGNGACTGGCGCTGCTGCTCCTGCTGGCCACCGTGTCGCAGTTACTGCAGC 60
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
6736R-2.in silico     1   GATTAGACTGG-GACTGGCGCTGCTGCTCCTGCTGGCCACCGTGTCGCAGTTACTGCAGC 60


6736R-2.IR_full       61  CGGTCCAGGGACGCCGAAAGATGTGCGGCGAGGCTCTGATCCAGGCACTGGATGTGATTT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6736R-2.in silico     61  CGGTCCAGGGACGCCGAAAGATGTGCGGCGAGGCTCTGATCCAGGCACTGGATGTGATTT 120


6736R-2.IR_full       121 GTGTTAATGGATTTACACGCCGTGTCAGGCGGAGCAGTGCGTCNTAAGGATGCTAGAGTG 180
                          ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
6736R-2.in silico     121 GTGTTAATGGATTTACACGCCGTGTCAGGCGGAGCAGTGCGTC-TAAGGATGCTAGAGTG 180


6736R-2.IR_full       181 CGAGACCTTATCCGTAAGCTACAGCAGCCGGATGAGGACATTGAACAGGAAACGGAAACG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6736R-2.in silico     181 CGAGACCTTATCCGTAAGCTACAGCAGCCGGATGAGGACATTGAACAGGAAACGGAAACG 240


6736R-2.IR_full       241 GGAAGGTTAAAGCAGAAGCATACGGATGCGGATACGGAGAAGGGTGTGCCACCGGCCGTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6736R-2.in silico     241 GGAAGGTTAAAGCAGAAGCATACGGATGCGGATACGGAGAAGGGTGTGCCACCGGCCGTC 300


6736R-2.IR_full       301 GGAAGTGGACGAAAGTTGCGACGCCATCGGNGACGCATCGCCCACGAGTGTTGCAAGGAG 360
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
6736R-2.in silico     301 GGAAGTGGACGAAAGTTGCGACGCCATCGGCGACGCATCGCCCACGAGTGTTGCAAGGAG 360


6736R-2.IR_full       361 GGCTGCACCTACGACGATATACTGGACTANCTGCGC 396
                          ||||||||||||||||||||||||||||| ||||||
6736R-2.in silico     361 GGCTGCACCTACGACGATATACTGGACTA-CTGCGC 396

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   375  NM_140104.2  CG6736-RA (Ilp4), mRNA 
0.26   NM_132483.2  CG1737-RA (CG1737), mRNA 
0.26   NM_141002.1  CG11451-RA (CG11451), mRNA 
0   NM_080319.3  CG4125-RA (rst), mRNA 
0   10  NM_079713.2  CG6376-RA, transcript variant A (E2f), mRNA 
0   10  NM_169962.1  CG6376-RC, transcript variant C (E2f), mRNA 
0   10  NM_169961.1  CG6376-RB, transcript variant B (E2f), mRNA 
0   16  NM_132116.1  CG14441-RA (CG14441), mRNA 
0   NM_079720.2  CG6455-RA, transcript variant A (CG6455), mRNA 
0   NM_169988.1  CG6455-RB, transcript variant B (CG6455), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   11  NM_142844.1  CG7031-RA (CG7031), mRNA 
0   10  NM_164715.1  CG32828-RA (CG32828), mRNA 
0   NM_143582.1  CG15552-RA (Sox100B), mRNA 
0   NM_143025.1  CG13632-RA (CG13632), mRNA 
0   10  23  NM_132595.1  CG15725-RA (CG15725), mRNA 
0   36  NM_167330.2  CG17762-RD, transcript variant D (tomosyn), mRNA 
0   56  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_079105.2  CG4084-RA (l(2)not), mRNA 
0   19  NM_132779.1  CG15028-RB, transcript variant B (CG15028), mRNA 
0   NM_141884.3  CG14734-RA (Tk), mRNA 
0   14  NM_167320.1  CG32655-RA (CG32655), mRNA 
0   NM_139863.3  CG8560-RA (CG8560), mRNA 
0   39  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
0   14  NM_167431.1  CG15028-RA, transcript variant A (CG15028), mRNA 
0   11  NM_139786.1  CG13300-RA (CG13300), mRNA 
0   NM_079997.2  CG13580-RA (Crtp), mRNA 
0   NM_130694.2  CG14265-RB (CG14265), mRNA 
0   NM_132298.3  CG7039-RA (CG7039), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.