National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6728R-2 
 Symbol ninaG  Full Name ninaG 
 CG No CG6728  Old CG No CG6728 
 Synonyms CG6728, ninaG 
 Accession No (Link to NCBI) NM_141813.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGATTCCTCTCCATCATCGTT 
 Primer Seq. 3'
aatctagaggtaccGGAATTTCGAGCATGTCTGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGATTCCTCT CCATCATCGT TGTCCTGGCC GGCACGCTGC TTAAGAACTC CGTACCCCAA 
0061 TGTCTTGGCA CCAGTGGAGC GGCACTTTGC ATTTGACTAC GTGATTGTGG GTGGTGGAAC 
0121 TGGAGGCAGC ACACTTACCT CGCTACTGGC CAAAAACAGC AATGGGAGTG TTCTTCTCAT 
0181 CGAGGCAGGT GGTCAGTTTG GCCTCCTGAG TCGGATTCCC TTGCTGACCA CCTTTCAGCA 
0241 GAAGGGCATC AATGACTGGT CGTTCCTTTC TGTGCCACAG AAACACTCCT CCAGAGGTCT 
0301 CATTGAACGA AGGCAGTGCC TCCCGAGGGG CAAAGGACTG GGTGGATCCG CCAATCTGAA 
0361 CTACATGCTG CACTTCGATG GTCATGGACC GGATTTTGAT TCCTGGCGGG ATCACCACAA 
0421 TCTTAGCGAT TGGAGCTGGG CCCAAATGAG ATCTTTTATG GNTGCCGNCA AGCCCAAGAA 
0481 CCCAGACATG CTCGAAATTC C 
 in silico PCR Fragment
0001 GGATTCCTCT CCATCATCGT TGTCCTGGCC GGCACGCTGC TTAAGAACTC CGTA-CCCAA 
0061 TGTCTTGGCA CCAGTGGAGC GGCACTTTGC ATTTGACTAC GTGATTGTGG GTGGTGGAAC 
0121 TGGAGGCAGC ACACTTACCT CGCTACTGGC CAAAAACAGC AATGGGAGTG TTCTTCTCAT 
0181 CGAGGCAGGT GGTCAGTTTG GCCTCCTGAG TCGGATTCCC TTGCTGACCA CCTTTCAGCA 
0241 GAAGGGCATC AATGACTGGT CGTTCCTTTC TGTGCCACAG AAACACTCCT CCAGAGGTCT 
0301 CATTGAACGA AGGCAGTGCC TCCCGAGGGG CAAAGGACTG GGTGGATCCG CCAATCTGAA 
0361 CTACATGCTG CACTTCGATG GTCATGGACC GGATTTTGAT TCCTGGCGGG ATCACCACAA 
0421 TCTTAGCGAT TGGAGCTGGG CCCAAATGAG ATCTTTTATG GCTGCCGCCA AGCCCAAGAA 
0481 CCCAGACATG CTCGAAATTC C 
 Assemble Data

6728R-2.IR_full       1   GGATTCCTCTCCATCATCGTTGTCCTGGCCGGCACGCTGCTTAAGAACTCCGTACCCCAA 60
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
6728R-2.in silico     1   GGATTCCTCTCCATCATCGTTGTCCTGGCCGGCACGCTGCTTAAGAACTCCGTA-CCCAA 60


6728R-2.IR_full       61  TGTCTTGGCACCAGTGGAGCGGCACTTTGCATTTGACTACGTGATTGTGGGTGGTGGAAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6728R-2.in silico     61  TGTCTTGGCACCAGTGGAGCGGCACTTTGCATTTGACTACGTGATTGTGGGTGGTGGAAC 120


6728R-2.IR_full       121 TGGAGGCAGCACACTTACCTCGCTACTGGCCAAAAACAGCAATGGGAGTGTTCTTCTCAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6728R-2.in silico     121 TGGAGGCAGCACACTTACCTCGCTACTGGCCAAAAACAGCAATGGGAGTGTTCTTCTCAT 180


6728R-2.IR_full       181 CGAGGCAGGTGGTCAGTTTGGCCTCCTGAGTCGGATTCCCTTGCTGACCACCTTTCAGCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6728R-2.in silico     181 CGAGGCAGGTGGTCAGTTTGGCCTCCTGAGTCGGATTCCCTTGCTGACCACCTTTCAGCA 240


6728R-2.IR_full       241 GAAGGGCATCAATGACTGGTCGTTCCTTTCTGTGCCACAGAAACACTCCTCCAGAGGTCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6728R-2.in silico     241 GAAGGGCATCAATGACTGGTCGTTCCTTTCTGTGCCACAGAAACACTCCTCCAGAGGTCT 300


6728R-2.IR_full       301 CATTGAACGAAGGCAGTGCCTCCCGAGGGGCAAAGGACTGGGTGGATCCGCCAATCTGAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6728R-2.in silico     301 CATTGAACGAAGGCAGTGCCTCCCGAGGGGCAAAGGACTGGGTGGATCCGCCAATCTGAA 360


6728R-2.IR_full       361 CTACATGCTGCACTTCGATGGTCATGGACCGGATTTTGATTCCTGGCGGGATCACCACAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6728R-2.in silico     361 CTACATGCTGCACTTCGATGGTCATGGACCGGATTTTGATTCCTGGCGGGATCACCACAA 420


6728R-2.IR_full       421 TCTTAGCGATTGGAGCTGGGCCCAAATGAGATCTTTTATGGNTGCCGNCAAGCCCAAGAA 480
                          ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||
6728R-2.in silico     421 TCTTAGCGATTGGAGCTGGGCCCAAATGAGATCTTTTATGGCTGCCGCCAAGCCCAAGAA 480


6728R-2.IR_full       481 CCCAGACATGCTCGAAATTCC 501
                          |||||||||||||||||||||
6728R-2.in silico     481 CCCAGACATGCTCGAAATTCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141813.2  CG6728-RA (ninaG), mRNA 
0   NM_135755.1  CG9932-RA (CG9932), mRNA 
0   NM_137748.2  CG10080-RA (CG10080), mRNA 
0   NM_136174.1  CG10659-RA (CG10659), mRNA 
0   NM_136539.1  CG11669-RA (CG11669), mRNA 
0   NM_165829.2  CG9027-RA, transcript variant A (CG9027), mRNA 
0   NM_136838.2  CG9027-RB, transcript variant B (CG9027), mRNA 
0   NM_001038850.1  CG9027-RC, transcript variant C (CG9027), mRNA 
0   NM_139495.1  CG9973-RA (CG9973), mRNA 
0   NM_205945.1  CG3811-RD, transcript variant D (Oatp30B), mRNA 
0   NM_135449.2  CG3811-RB, transcript variant B (Oatp30B), mRNA 
0   NM_205946.1  CG3811-RC, transcript variant C (Oatp30B), mRNA 
0   NM_164857.1  CG3811-RA, transcript variant A (Oatp30B), mRNA 
0   NM_132069.2  CG32754-RA (vanin-like), mRNA 
0   12  NM_143061.1  CG13648-RA (tnc), mRNA 
0   NM_142862.1  CG17111-RA (CG17111), mRNA 
0   NM_139362.2  CG12091-RA (CG12091), mRNA 
0   NM_136326.1  CG30437-RC, transcript variant C (CG30437), mRNA 
0   NM_142363.4  CG5407-RB, transcript variant B (Sur-8), mRNA 
0   NM_169758.1  CG5407-RA, transcript variant A (Sur-8), mRNA 
0   NM_057242.3  CG7765-RA (Khc), mRNA 
0   10  NM_132660.2  CG1716-RA (CG1716), mRNA 
0   NM_142783.2  CG13849-RA (Nop56), mRNA 
0   NM_139271.1  CG9522-RA (CG9522), mRNA 
0   NM_135554.2  CG5300-RA (Klp31E), mRNA 
0   NM_057425.2  CG9450-RA (tud), mRNA 
0   NM_168742.2  CG6143-RA, transcript variant A (Pep), mRNA 
0   NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
0   NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
0   NM_206396.1  CG6143-RC, transcript variant C (Pep), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.