National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6627R-4 
 Symbol Dnz1  Full Name DNZDHHC/NEW1 zinc finger protein 11 
 CG No CG6627  Old CG No CG6627 
 Synonyms DNZ1, CG6627, Dnz1 
 Accession No (Link to NCBI) NM_058101.3 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCAGTTCTGTACGCGGACTAT 
 Primer Seq. 3'
aatctagaggtaccAACTGGGTTTCGATCACGTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCAGTTCTGT ACGCGGACTA TGTGGTCATC CGTTGGATCA TTCTGACCAC CATGCCGGGC 
0061 AGCCTCTGGA TGTCCTTCCA TGTGGTACTC TTTAACACCG TCGTCTTCCT GTTGGCCATG 
0121 TCCCACTCCA AGGCCGTGTT CTCCGATCCA GGCACTGTGC CGCNTGCCCG CCAACCGTCT 
0181 GGACTTCTCC GACCTGCACA CGACCAACAA AAACAATCCT CCGCCCGGTA ATGGACACAG 
0241 CAGCGAGTGG ACCGTGTGCA CCCGCTGCGA AACGTATAGG CCGCCGCGCG CCCACCATTG 
0301 TCGCATCTGC AAGCGTTGCA TCCGGCGCAT GGATCACCAC TGCCCCTGGA TCAACAACTG 
0361 TGTGGGCGAG CGCAATCAAA AGTACTTCCT GCAGTTCCTC ATCTACGTGG CGCTGCTGTC 
0421 GCTCTACTCC ATTGCCCTTA TCGTCGGTTC CTGGGTGTGG CCCTGCGAGG AGTGCAGCCA 
0481 GAACGTGATC GAAACCCAGT T 
 in silico PCR Fragment
0001 GCAGTTCTGT ACGCGGACTA TGTGGTCATC CGTTGGATCA TTCTGACCAC CATGCCGGGC 
0061 AGCCTCTGGA TGTCCTTCCA TGTGGTGCTC TTTAACACCG TCGTCTTCCT GTTGGCCATG 
0121 TCCCACTCCA AGGCCGTGTT CTCCGATCCA GGCACTGTGC CGC-TGCCCG CCAATCGTCT 
0181 GGACTTCTCC GACCTGCACA CGACCAACAA AAACAATCCT CCGCCCGGTA ATGGACACAG 
0241 CAGCGAATGG ACCGTGTGCA CCCGCTGCGA AACGTATAGG CCGCCACGCG CCCATCATTG 
0301 TCGCATCTGC AAGCGGTGCA TCCGGCGCAT GGATCACCAC TGCCCCTGGA TCAACAACTG 
0361 TGTGGGCGAG CGCAATCAGA AGTACTTCCT GCAGTTCCTC ATCTACGTGG CGCTGCTGTC 
0421 GCTCTACTCC ATTGCCCTTA TCGTCGGTTC CTGGGTGTGG CCCTGCGAGG AGTGCAGCCA 
0481 GAACGTGATC GAAACCCAGT T 
 Assemble Data

6627R-4.IR_full       1   GCAGTTCTGTACGCGGACTATGTGGTCATCCGTTGGATCATTCTGACCACCATGCCGGGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6627R-4.in silico     1   GCAGTTCTGTACGCGGACTATGTGGTCATCCGTTGGATCATTCTGACCACCATGCCGGGC 60


6627R-4.IR_full       61  AGCCTCTGGATGTCCTTCCATGTGGTACTCTTTAACACCGTCGTCTTCCTGTTGGCCATG 120
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
6627R-4.in silico     61  AGCCTCTGGATGTCCTTCCATGTGGTGCTCTTTAACACCGTCGTCTTCCTGTTGGCCATG 120


6627R-4.IR_full       121 TCCCACTCCAAGGCCGTGTTCTCCGATCCAGGCACTGTGCCGCNTGCCCGCCAACCGTCT 180
                          ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||
6627R-4.in silico     121 TCCCACTCCAAGGCCGTGTTCTCCGATCCAGGCACTGTGCCGC-TGCCCGCCAATCGTCT 180


6627R-4.IR_full       181 GGACTTCTCCGACCTGCACACGACCAACAAAAACAATCCTCCGCCCGGTAATGGACACAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6627R-4.in silico     181 GGACTTCTCCGACCTGCACACGACCAACAAAAACAATCCTCCGCCCGGTAATGGACACAG 240


6627R-4.IR_full       241 CAGCGAGTGGACCGTGTGCACCCGCTGCGAAACGTATAGGCCGCCGCGCGCCCACCATTG 300
                          |||||| |||||||||||||||||||||||||||||||||||||| |||||||| |||||
6627R-4.in silico     241 CAGCGAATGGACCGTGTGCACCCGCTGCGAAACGTATAGGCCGCCACGCGCCCATCATTG 300


6627R-4.IR_full       301 TCGCATCTGCAAGCGTTGCATCCGGCGCATGGATCACCACTGCCCCTGGATCAACAACTG 360
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
6627R-4.in silico     301 TCGCATCTGCAAGCGGTGCATCCGGCGCATGGATCACCACTGCCCCTGGATCAACAACTG 360


6627R-4.IR_full       361 TGTGGGCGAGCGCAATCAAAAGTACTTCCTGCAGTTCCTCATCTACGTGGCGCTGCTGTC 420
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
6627R-4.in silico     361 TGTGGGCGAGCGCAATCAGAAGTACTTCCTGCAGTTCCTCATCTACGTGGCGCTGCTGTC 420


6627R-4.IR_full       421 GCTCTACTCCATTGCCCTTATCGTCGGTTCCTGGGTGTGGCCCTGCGAGGAGTGCAGCCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6627R-4.in silico     421 GCTCTACTCCATTGCCCTTATCGTCGGTTCCTGGGTGTGGCCCTGCGAGGAGTGCAGCCA 480


6627R-4.IR_full       481 GAACGTGATCGAAACCCAGTT 501
                          |||||||||||||||||||||
6627R-4.in silico     481 GAACGTGATCGAAACCCAGTT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058101.3  CG6627-RA (Dnz1), mRNA 
0.62   10  NM_165728.2  CG1407-RA, transcript variant A (CG1407), mRNA 
0.62   10  NM_136700.2  CG1407-RB, transcript variant B (CG1407), mRNA 
0   17  NM_206479.1  CG5196-RB, transcript variant B (CG5196), mRNA 
0   17  NM_141934.1  CG5196-RA, transcript variant A (CG5196), mRNA 
0   NM_140567.2  CG6017-RA (CG6017), mRNA 
0   NM_137909.2  CG9882-RA (Art7), mRNA 
0   NM_137297.1  CG8303-RA (CG8303), mRNA 
0   NM_140037.1  CG4483-RA (CG4483), mRNA 
0   NM_167439.1  CG9164-RB, transcript variant B (CG9164), mRNA 
0   NM_167440.1  CG9164-RC, transcript variant C (CG9164), mRNA 
0   NM_132793.2  CG9164-RA, transcript variant A (CG9164), mRNA 
0   12  NM_143320.2  CG18437-RA (CG18437), mRNA 
0   NM_132277.2  CG11354-RA (Lim1), mRNA 
0   NM_130615.2  CG4313-RA, transcript variant A (CG4313), mRNA 
0   NM_001038735.1  CG4313-RB, transcript variant B (CG4313), mRNA 
0   NM_001042849.1  CG40485-RA, transcript variant A (CG40485), mRNA 
0   NM_001042848.1  CG40485-RB, transcript variant B (CG40485), mRNA 
0   NM_057546.2  CG3090-RA, transcript variant A (Sox14), mRNA 
0   NM_134290.1  CG3090-RB, transcript variant B (Sox14), mRNA 
0   NM_079741.2  CG10210-RA (tst), mRNA 
0   NM_165089.2  CG3479-RA, transcript variant A (osp), mRNA 
0   NM_078843.4  CG3479-RB, transcript variant B (osp), mRNA 
0   NM_078993.2  CG8604-RA (Amph), mRNA 
0   NM_132515.2  CG1841-RA, transcript variant A (Tango10), mRNA 
0   NM_167302.1  CG1841-RB, transcript variant B (Tango10), mRNA 
0   NM_166185.1  CG5072-RC, transcript variant C (Cdk4), mRNA 
0   NM_166184.1  CG5072-RA, transcript variant A (Cdk4), mRNA 
0   NM_057848.2  CG5072-RB, transcript variant B (Cdk4), mRNA 
0   NM_057311.4  CG6246-RA (nub), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.