National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6627R-3 
 Symbol Dnz1  Full Name DNZDHHC/NEW1 zinc finger protein 11 
 CG No CG6627  Old CG No CG6627 
 Synonyms DNZ1, CG6627, Dnz1 
 Accession No (Link to NCBI) NM_058101.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCAGTTCTGTACGCGGACTATGTGGTCATCCGTTGGATCATTCTGACCACCATGCCGGGC 60

                          |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| silico     61  AGCCTCTGGATGTCCTTCCATGTGGTGCTCTTTAACACCGTCGTCTTCCTGTTGGCCATG 120

                          ||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| silico     121 TCCCACTCCAAGGCCGTGTTCTCCGATCCAGGCACTGTGCCGC-TGCCCGCCAATCGTCT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGACTTCTCCGACCTGCACACGACCAACAAAAACAATCCTCCGCCCGGTAATGGACACAG 240

                          |||||| |||||||||||||||||||||||||||||||||||||| |||||||| ||||| silico     241 CAGCGAATGGACCGTGTGCACCCGCTGCGAAACGTATAGGCCGCCACGCGCCCATCATTG 300

                          ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| silico     301 TCGCATCTGCAAGCGGTGCATCCGGCGCATGGATCACCACTGCCCCTGGATCAACAACTG 360

                          |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     361 TGTGGGCGAGCGCAATCAGAAGTACTTCCTGCAGTTCCTCATCTACGTGGCGCTGCTGTC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCTCTACTCCATTGCCCTTATCGTCGGTTCCTGGGTGTGGCCCTGCGAGGAGTGCAGCCA 480

6627R-3.IR_full       481 GAACGTGATCGAAACCCAGTT 501
                          ||||||||||||||||||||| silico     481 GAACGTGATCGAAACCCAGTT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058101.3  CG6627-RA (Dnz1), mRNA 
0.62   10  NM_165728.2  CG1407-RA, transcript variant A (CG1407), mRNA 
0.62   10  NM_136700.2  CG1407-RB, transcript variant B (CG1407), mRNA 
0   17  NM_206479.1  CG5196-RB, transcript variant B (CG5196), mRNA 
0   17  NM_141934.1  CG5196-RA, transcript variant A (CG5196), mRNA 
0   NM_140567.2  CG6017-RA (CG6017), mRNA 
0   NM_137909.2  CG9882-RA (Art7), mRNA 
0   NM_137297.1  CG8303-RA (CG8303), mRNA 
0   NM_140037.1  CG4483-RA (CG4483), mRNA 
0   NM_167439.1  CG9164-RB, transcript variant B (CG9164), mRNA 
0   NM_167440.1  CG9164-RC, transcript variant C (CG9164), mRNA 
0   NM_132793.2  CG9164-RA, transcript variant A (CG9164), mRNA 
0   12  NM_143320.2  CG18437-RA (CG18437), mRNA 
0   NM_132277.2  CG11354-RA (Lim1), mRNA 
0   NM_130615.2  CG4313-RA, transcript variant A (CG4313), mRNA 
0   NM_001038735.1  CG4313-RB, transcript variant B (CG4313), mRNA 
0   NM_001042849.1  CG40485-RA, transcript variant A (CG40485), mRNA 
0   NM_001042848.1  CG40485-RB, transcript variant B (CG40485), mRNA 
0   NM_057546.2  CG3090-RA, transcript variant A (Sox14), mRNA 
0   NM_134290.1  CG3090-RB, transcript variant B (Sox14), mRNA 
0   NM_079741.2  CG10210-RA (tst), mRNA 
0   NM_165089.2  CG3479-RA, transcript variant A (osp), mRNA 
0   NM_078843.4  CG3479-RB, transcript variant B (osp), mRNA 
0   NM_078993.2  CG8604-RA (Amph), mRNA 
0   NM_132515.2  CG1841-RA, transcript variant A (Tango10), mRNA 
0   NM_167302.1  CG1841-RB, transcript variant B (Tango10), mRNA 
0   NM_166185.1  CG5072-RC, transcript variant C (Cdk4), mRNA 
0   NM_166184.1  CG5072-RA, transcript variant A (Cdk4), mRNA 
0   NM_057848.2  CG5072-RB, transcript variant B (Cdk4), mRNA 
0   NM_057311.4  CG6246-RA (nub), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.