National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6586R-1 
 Symbol tan  Full Name tantalus 
 CG No CG6586  Old CG No CG6586 
 Synonyms CG6586, tan, Tan 
 Accession No (Link to NCBI) NM_080043.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zool. Sci. (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACATGGAGGAGATGCAGGAC 
 Primer Seq. 3'
aatctagaggtaccGATATTGCCCGGCGGAGTTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GACATGGAGG AGATGCAGGA CACATCCGAG CCCATAGCTC CACCCGAATC CGATGACAAT 
0061 GTCAGCAGTG AATCGCAAGA CTCCGACGAT GTAGACTCGC AATTGAGTCG CTGCGAGGAC 
0121 AACGATGACG ACAGCGATTG CATCAGTGGA TCCTCCAGAC GCAGTTCCAC TTTTGGAGCT 
0181 CGAGCGGGCG TGGCTCGTCG CAGAATGCCC GCCAGGGTGT CCAAGGACAA CTTTAACCGG 
0241 ATCTGCAGCG CCATCATGAA ACCCATCAAA AAGAAGCAAC GCAAAGAACT GAACACAAAT 
0301 GCCCAAACAC TTAAAAGCAT CGAAAAGATC TACACCAGCA GGCGCATGAA AAAGTTCACG 
0361 CCCACCAATC TGGAGACAAT CTTCGAGGAA CCCAGCGATG AGAATGCCGC CGATGCAGAG 
0421 GACGACAGCG AAGAGTGCTC CATCAGCAGC CAAGTGAAAG TAGTTAAGGT GTGGGGTCGC 
0481 AAACTCCGCC GGGCAATATC  
 in silico PCR Fragment
0001 GACATGGAGG AGATGCAGGA CACATCCGAG CCCATAGCTC CACCCGAATC CGATGACAAT 
0061 GTCAGCAGTG AATCGCATGA CTCCGACGAT GTAGACTCGC AATTGAGTCG CTGCGAGGAC 
0121 AACGATGACG ACAGCGATTG CATCAGTGGA TCCTCCAGAC GCAGTTCCAC TTTTGGAGCT 
0181 CGAGCGGGCG TGGCTCGTCG CAGAATGCCC GCCAGGGTGT CCAAGGACAA CTTTAACCGG 
0241 ATCTGCAGCG CCATCATGAA ACCCATCAAA AAGAAGCAAC GCAAAGAACT GAACACAAAT 
0301 GCCCAAACAC TTAAAAGCAT CGAAAAGATC TACACCAGCA GGCGCATGAA AAAGTTCACG 
0361 CCCACCAATC TGGAGACAAT CTTCGAGGAA CCCAGCGATG AGAATGCCGC CGATGCAGAG 
0421 GACGACAGCG AAGAGTGCTC CATCAGCAGC CAAGTGAAAG TAGTTAAGGT GTGGGGTCGC 
0481 AAACTCCGCC GGGCAATATC  
 Assemble Data

6586R-1.IR_full       1   GACATGGAGGAGATGCAGGACACATCCGAGCCCATAGCTCCACCCGAATCCGATGACAAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6586R-1.in silico     1   GACATGGAGGAGATGCAGGACACATCCGAGCCCATAGCTCCACCCGAATCCGATGACAAT 60


6586R-1.IR_full       61  GTCAGCAGTGAATCGCAAGACTCCGACGATGTAGACTCGCAATTGAGTCGCTGCGAGGAC 120
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
6586R-1.in silico     61  GTCAGCAGTGAATCGCATGACTCCGACGATGTAGACTCGCAATTGAGTCGCTGCGAGGAC 120


6586R-1.IR_full       121 AACGATGACGACAGCGATTGCATCAGTGGATCCTCCAGACGCAGTTCCACTTTTGGAGCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6586R-1.in silico     121 AACGATGACGACAGCGATTGCATCAGTGGATCCTCCAGACGCAGTTCCACTTTTGGAGCT 180


6586R-1.IR_full       181 CGAGCGGGCGTGGCTCGTCGCAGAATGCCCGCCAGGGTGTCCAAGGACAACTTTAACCGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6586R-1.in silico     181 CGAGCGGGCGTGGCTCGTCGCAGAATGCCCGCCAGGGTGTCCAAGGACAACTTTAACCGG 240


6586R-1.IR_full       241 ATCTGCAGCGCCATCATGAAACCCATCAAAAAGAAGCAACGCAAAGAACTGAACACAAAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6586R-1.in silico     241 ATCTGCAGCGCCATCATGAAACCCATCAAAAAGAAGCAACGCAAAGAACTGAACACAAAT 300


6586R-1.IR_full       301 GCCCAAACACTTAAAAGCATCGAAAAGATCTACACCAGCAGGCGCATGAAAAAGTTCACG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6586R-1.in silico     301 GCCCAAACACTTAAAAGCATCGAAAAGATCTACACCAGCAGGCGCATGAAAAAGTTCACG 360


6586R-1.IR_full       361 CCCACCAATCTGGAGACAATCTTCGAGGAACCCAGCGATGAGAATGCCGCCGATGCAGAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6586R-1.in silico     361 CCCACCAATCTGGAGACAATCTTCGAGGAACCCAGCGATGAGAATGCCGCCGATGCAGAG 420


6586R-1.IR_full       421 GACGACAGCGAAGAGTGCTCCATCAGCAGCCAAGTGAAAGTAGTTAAGGTGTGGGGTCGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6586R-1.in silico     421 GACGACAGCGAAGAGTGCTCCATCAGCAGCCAAGTGAAAGTAGTTAAGGTGTGGGGTCGC 480


6586R-1.IR_full       481 AAACTCCGCCGGGCAATATC 500
                          ||||||||||||||||||||
6586R-1.in silico     481 AAACTCCGCCGGGCAATATC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080043.2  CG6586-RA (tan), mRNA 
0   NM_168577.2  CG32134-RA, transcript variant A (btl), mRNA 
0   NM_001014583.1  CG32134-RB, transcript variant B (btl), mRNA 
0   NM_135754.2  CG9933-RA (A16), mRNA 
0   NM_141680.1  CG16908-RA (CG16908), mRNA 
0   NM_080258.2  CG10229-RA (katanin-60), mRNA 
0   NM_142747.1  CG13409-RA (CG13409), mRNA 
0   NM_144006.1  CG12509-RA (CG12509), mRNA 
0   NM_167835.1  CG12031-RB, transcript variant B (MED14), mRNA 
0   NM_138197.2  CG12031-RA, transcript variant A (MED14), mRNA 
0   NM_135180.1  CG9511-RA (CG9511), mRNA 
0   NM_132575.2  CG2560-RA (CG2560), mRNA 
0   NM_164688.1  CG31640-RA (CG31640), mRNA 
0   NM_142075.1  CG14358-RA (CG14358), mRNA 
0   NM_133036.1  CG15373-RA (CG15373), mRNA 
0   NM_168102.1  CG32239-RA (Gef64C), mRNA 
0   NM_176195.1  CG33017-RB (CG33017), mRNA 
0   NM_206674.1  CG32684-RE, transcript variant E (alpha-Man-I), mRNA 
0   NM_206673.1  CG32684-RF, transcript variant F (alpha-Man-I), mRNA 
0   NM_167223.1  CG32684-RA, transcript variant A (alpha-Man-I), mRNA 
0   NM_206672.1  CG32684-RG, transcript variant G (alpha-Man-I), mRNA 
0   NM_206675.1  CG32684-RD, transcript variant D (alpha-Man-I), mRNA 
0   NM_206676.1  CG32684-RC, transcript variant C (alpha-Man-I), mRNA 
0   NM_132589.2  CG15727-RA (CG15727), mRNA 
0   NM_057770.3  CG3193-RA (crn), mRNA 
0   NM_134626.1  CG17599-RA (CG17599), mRNA 
0   NM_137843.2  CG4329-RA, transcript variant A (CG4329), mRNA 
0   NM_130578.2  CG32809-RD, transcript variant D (CG32809), mRNA 
0   NM_206353.1  CG32146-RB, transcript variant B (dlp), mRNA 
0   NM_079347.2  CG32146-RA, transcript variant A (dlp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.