National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6553R-4 
 Symbol CG6553  Full Name CG6553 
 CG No CG6553  Old CG No CG6553 
 Synonyms CG6553 
 Accession No (Link to NCBI) NM_137067.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTAGCCGTCACCATTTGCTTG 
 Primer Seq. 3'
aatctagaggtaccCTTGTTACAGGAACAGTGGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTAGCCGTCA CCATTTGCTT GGGATCCCAA AATGCCACAA GCTGCGGGCA TCGCTGTGGA 
0061 GGAGGCGACT GTATCCAACT GGACCAGCTG TGCGAGTGGG AGCGCCAACT GCTTGGATGG 
0121 TTCCGATGAG ACGGTCGCCA TGTGTGAGAA GGTCTGGTGT CCGGGTTATG CATTCCGCTG 
0181 CAGCTACGGT GCGTGTATAG CCAGCACAGC GGTTTGCGAT GGCGTCCAGG ACTGCGTGGA 
0241 TGGTTCGGAT GAGCAGGGTT GGCTGTGCCG GGCGCAGATG CAGCAGGCTA ACTGCGACAA 
0301 CTGGGAAATG TACTGCTCCT CTGGCCAATG CATGACCTAT TCCAAATTGT GTGATGGCAT 
0361 CCGTGACTGC CGAGATGGAG ACGATGAGCT GGAGTCCCTT TGCGAGGGCG TTACCATACC 
0421 AACGACTACA GTCAGTTCAA CGACAAGTAC AACTACGGAA AGTAGTATCC ATAGGATAAC 
0481 TCCCACTGTT CCTGTAACAA G 
 in silico PCR Fragment
0001 TTAGCCGTCA CCATTTGCTT GGGATCCCAA AATGCCACAA GCTGCGGGCA TCGCTGTGGA 
0061 GGAGGCGACT GTATCCAACT GGACCAGCTG TGCGA-TGGG AGCGCCAACT GCTTGGATGG 
0121 TTCCGATGAG ACGGTCGCCA TGTGTGAGAA GGTCTGGTGT CCGGGTTATG CATTTCGCTG 
0181 CAGCTACGGT GCGTGCATAG CCAGCACAGC GGTTTGCGAT GGCGTCCAGG ACTGCGTGGA 
0241 TGGTTCGGAT GAGCAGGGTT GGCTGTGCCG GGCGCAGATG CAGCAGGCTA ACTGCGACAA 
0301 CTGGGAAATG TACTGCTCCT CTGGCCAATG CATGACCTAT TCCAAATTGT GTGATGGCAT 
0361 CCGTGACTGC CGAGATGGAG ACGATGAGCT GGAGTCCCTT TGCGAGGGCG TTACCATACC 
0421 AACGACTACA GTCAGTTCAA CGACAAGTAC AACTACGGAA AGTAGTATCC ATAGGATAAC 
0481 TCCCACTGTT CCTGTAACAA G 
 Assemble Data

6553R-4.IR_full       1   TTAGCCGTCACCATTTGCTTGGGATCCCAAAATGCCACAAGCTGCGGGCATCGCTGTGGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6553R-4.in silico     1   TTAGCCGTCACCATTTGCTTGGGATCCCAAAATGCCACAAGCTGCGGGCATCGCTGTGGA 60


6553R-4.IR_full       61  GGAGGCGACTGTATCCAACTGGACCAGCTGTGCGAGTGGGAGCGCCAACTGCTTGGATGG 120
                          ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
6553R-4.in silico     61  GGAGGCGACTGTATCCAACTGGACCAGCTGTGCGA-TGGGAGCGCCAACTGCTTGGATGG 120


6553R-4.IR_full       121 TTCCGATGAGACGGTCGCCATGTGTGAGAAGGTCTGGTGTCCGGGTTATGCATTCCGCTG 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
6553R-4.in silico     121 TTCCGATGAGACGGTCGCCATGTGTGAGAAGGTCTGGTGTCCGGGTTATGCATTTCGCTG 180


6553R-4.IR_full       181 CAGCTACGGTGCGTGTATAGCCAGCACAGCGGTTTGCGATGGCGTCCAGGACTGCGTGGA 240
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
6553R-4.in silico     181 CAGCTACGGTGCGTGCATAGCCAGCACAGCGGTTTGCGATGGCGTCCAGGACTGCGTGGA 240


6553R-4.IR_full       241 TGGTTCGGATGAGCAGGGTTGGCTGTGCCGGGCGCAGATGCAGCAGGCTAACTGCGACAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6553R-4.in silico     241 TGGTTCGGATGAGCAGGGTTGGCTGTGCCGGGCGCAGATGCAGCAGGCTAACTGCGACAA 300


6553R-4.IR_full       301 CTGGGAAATGTACTGCTCCTCTGGCCAATGCATGACCTATTCCAAATTGTGTGATGGCAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6553R-4.in silico     301 CTGGGAAATGTACTGCTCCTCTGGCCAATGCATGACCTATTCCAAATTGTGTGATGGCAT 360


6553R-4.IR_full       361 CCGTGACTGCCGAGATGGAGACGATGAGCTGGAGTCCCTTTGCGAGGGCGTTACCATACC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6553R-4.in silico     361 CCGTGACTGCCGAGATGGAGACGATGAGCTGGAGTCCCTTTGCGAGGGCGTTACCATACC 420


6553R-4.IR_full       421 AACGACTACAGTCAGTTCAACGACAAGTACAACTACGGAAAGTAGTATCCATAGGATAAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6553R-4.in silico     421 AACGACTACAGTCAGTTCAACGACAAGTACAACTACGGAAAGTAGTATCCATAGGATAAC 480


6553R-4.IR_full       481 TCCCACTGTTCCTGTAACAAG 501
                          |||||||||||||||||||||
6553R-4.in silico     481 TCCCACTGTTCCTGTAACAAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  10  NM_137067.1  CG6553-RA (CG6553), mRNA 
0   23  NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   21  NM_001031862.1  CG33950-RC, transcript variant C (trol), mRNA 
0   21  NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 
0   21  NM_001031866.1  CG33950-RA, transcript variant A (trol), mRNA 
0   21  NM_001031863.1  CG33950-RD, transcript variant D (trol), mRNA 
0   21  NM_001031865.1  CG33950-RB, transcript variant B (trol), mRNA 
0   NM_133031.1  CG6847-RA (CG6847), mRNA 
0   NM_058116.3  CG10047-RA (SytIV), mRNA 
0   16  NM_080515.2  CG31217-RA (CG31217), mRNA 
0   NM_139443.1  CG13809-RA (osm-1), mRNA 
0   NM_142545.1  CG3734-RA (CG3734), mRNA 
0   NM_137915.3  CG3219-RA (Klp59C), mRNA 
0   NM_170239.2  CG31092-RA, transcript variant A (LpR2), mRNA 
0   NM_176565.1  CG31092-RB, transcript variant B (LpR2), mRNA 
0   NM_142620.1  CG15684-RA (CG15684), mRNA 
0   NM_135401.1  CG9289-RA (CG9289), mRNA 
0   NM_136382.1  CG30445-RA (Tdc1), mRNA 
0   NM_057738.3  CG3969-RA, transcript variant A (PR2), mRNA 
0   NM_057739.3  CG3969-RB, transcript variant B (PR2), mRNA 
0   14  46  NM_132335.2  CG12139-RB (CG12139), mRNA 
0   24  NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_136473.2  CG1941-RA (CG1941), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_057390.4  CG1391-RB, transcript variant B (sol), mRNA 
0   NM_206802.1  CG1391-RC, transcript variant C (sol), mRNA 
0   NM_057389.4  CG1391-RA, transcript variant A (sol), mRNA 
0   NM_206801.1  CG1391-RD, transcript variant D (sol), mRNA 
0   NM_136292.1  CG15216-RA (CG15216), mRNA 
0   NM_135494.1  CG13127-RA (CG13127), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.