National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6518R-2 
 Symbol inaC  Full Name inactivation no afterpotential C 
 CG No CG6518  Old CG No CG6518 
 Synonyms InaC, PKC, INAC, CG6518, eye PKC, PKCi, eye-PKC, PKC 53E, ePKC, unnamed, dPKC53E(ey), Dpkc2, pkc-2, dPKC53E, Pkc2, inaC 
 Accession No (Link to NCBI) NM_057515.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTGGCAAAGGTCCAGGAAAT 
 Primer Seq. 3'
aatctagaggtaccAGTAGTTTACCCCTCACCTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTGGCAAAG GTCCAGGAAA TCTACTGGAG ATCACTGGCG AAGCAAATAT CGTCAACTAT 
0061 ATGAAGAATC GTCTAAGGAA GGGTGCGATG AAGCGAAAGG GTCTCGAAAT GGTCAATGGT 
0121 CATCGTTTCG GAGTTAGATT CTTTAAGAAT CCAACCTACT GCGGTCATTG CAAGGATTTC 
0181 ATCTGGGGCT TTGGCAAGCA AGGTTTTCAG TGCGAGGAAT GCCGCTTCAA CATTCACCAG 
0241 AAGTGCTGTA AATTTGTGGT GTTCAAATGT CCTGGCAAGG ACACGGACTT CGATGCCNNC 
0301 TGCGCTAAGG TGAAGCACGG CTGGATTTCC ACCACCTACA CCACACCGAC ATTCTGCGAC 
0361 GAGTGCGGAC TGCTGCTCCA TGGNAGtcNC CCATCAGGGC GTCAAGTGCG AGAATTGCAA 
0421 CCTAAATGTG CATCACGCCT GCCAGGAGAC AGTGCCACCG ATGTGTGGTG CGGACATCAG 
0481 CGAGGTGAGG GGTAAACTAC T 
 in silico PCR Fragment
0001 GCTGGCAAAG GTCCAGGAAA TCTACTGGAG ATCACTGGCG AAGCAAATAT CGTCAACTAT 
0061 ATGAAGAATC GTCTAAGGAA GGGTGCGATG AAGCGAAAGG GTCTCGAAAT GGTCAATGGT 
0121 CATCGTTTCG GAGTTAGATT CTTTAAGAAT CCAACCTACT GCGGTCATTG CAAGGATTTC 
0181 ATCTGGGGCT TTGGCAAGCA AGGTTTTCAG TGCGAGGAAT GCCGCTTCAA CATTCACCAG 
0241 AAGTGCTGTA AATTTGTGGT GTTCAAATGT CCTGGCAAGG ACACGGACTT CGATGCCGAC 
0301 TGCGCTAAGG TGAAGCACGG CTGGATTTCC ACCACCTACA CCACACCGAC ATTCTGCGAC 
0361 GAGTGCGGAC TGCTGCTCCA TGG-AGTCGC CCATCAGGGC GTCAAGTGCG AGAATTGCAA 
0421 CCTAAATGTG CATCACGCCT GCCAGGAGAC AGTGCCACCG ATGTGTGGTG CGGACATCAG 
0481 CGAGGTGAGG GGTAAACTAC T 
 Assemble Data

6518R-2.IR_full       1   GCTGGCAAAGGTCCAGGAAATCTACTGGAGATCACTGGCGAAGCAAATATCGTCAACTAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6518R-2.in silico     1   GCTGGCAAAGGTCCAGGAAATCTACTGGAGATCACTGGCGAAGCAAATATCGTCAACTAT 60


6518R-2.IR_full       61  ATGAAGAATCGTCTAAGGAAGGGTGCGATGAAGCGAAAGGGTCTCGAAATGGTCAATGGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6518R-2.in silico     61  ATGAAGAATCGTCTAAGGAAGGGTGCGATGAAGCGAAAGGGTCTCGAAATGGTCAATGGT 120


6518R-2.IR_full       121 CATCGTTTCGGAGTTAGATTCTTTAAGAATCCAACCTACTGCGGTCATTGCAAGGATTTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6518R-2.in silico     121 CATCGTTTCGGAGTTAGATTCTTTAAGAATCCAACCTACTGCGGTCATTGCAAGGATTTC 180


6518R-2.IR_full       181 ATCTGGGGCTTTGGCAAGCAAGGTTTTCAGTGCGAGGAATGCCGCTTCAACATTCACCAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6518R-2.in silico     181 ATCTGGGGCTTTGGCAAGCAAGGTTTTCAGTGCGAGGAATGCCGCTTCAACATTCACCAG 240


6518R-2.IR_full       241 AAGTGCTGTAAATTTGTGGTGTTCAAATGTCCTGGCAAGGACACGGACTTCGATGCCNNC 300
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |
6518R-2.in silico     241 AAGTGCTGTAAATTTGTGGTGTTCAAATGTCCTGGCAAGGACACGGACTTCGATGCCGAC 300


6518R-2.IR_full       301 TGCGCTAAGGTGAAGCACGGCTGGATTTCCACCACCTACACCACACCGACATTCTGCGAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6518R-2.in silico     301 TGCGCTAAGGTGAAGCACGGCTGGATTTCCACCACCTACACCACACCGACATTCTGCGAC 360


6518R-2.IR_full       361 GAGTGCGGACTGCTGCTCCATGGNAGTCNCCCATCAGGGCGTCAAGTGCGAGAATTGCAA 420
                          ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||
6518R-2.in silico     361 GAGTGCGGACTGCTGCTCCATGG-AGTCGCCCATCAGGGCGTCAAGTGCGAGAATTGCAA 420


6518R-2.IR_full       421 CCTAAATGTGCATCACGCCTGCCAGGAGACAGTGCCACCGATGTGTGGTGCGGACATCAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6518R-2.in silico     421 CCTAAATGTGCATCACGCCTGCCAGGAGACAGTGCCACCGATGTGTGGTGCGGACATCAG 480


6518R-2.IR_full       481 CGAGGTGAGGGGTAAACTACT 501
                          |||||||||||||||||||||
6518R-2.in silico     481 CGAGGTGAGGGGTAAACTACT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057515.2  CG6518-RA (inaC), mRNA 
0.2   NM_165347.1  CG31675-RA (CG31675), mRNA 
0   NM_140175.2  CG6297-RB, transcript variant B (JIL-1), mRNA 
0   NM_168439.1  CG6297-RA, transcript variant A (JIL-1), mRNA 
0   NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_167189.2  CG32705-RA (CG32705), mRNA 
0   NM_142401.2  CG17806-RA (CG17806), mRNA 
0   NM_140308.2  CG4300-RB, transcript variant B (CG4300), mRNA 
0   NM_168496.1  CG4300-RA, transcript variant A (CG4300), mRNA 
0   NM_143409.1  CG11873-RA (CG11873), mRNA 
0   NM_169985.1  CG31465-RA (CG31465), mRNA 
0   15  19  NM_057334.2  CG6622-RA, transcript variant A (Pkc53E), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   NM_139624.2  CG11586-RA (CG11586), mRNA 
0   17  NM_166201.1  CG6622-RB, transcript variant B (Pkc53E), mRNA 
0   NM_001014453.1  CG33526-RD, transcript variant D (PNUTS), mRNA 
0   NM_141571.2  CG8223-RA (CG8223), mRNA 
0   NM_001043031.1  CG17800-RP, transcript variant P (Dscam), mRNA 
0   NM_206047.1  CG17800-RE, transcript variant E (Dscam), mRNA 
0   NM_001032245.1  CG13344-RB, transcript variant B (CG13344), mRNA 
0   NM_137071.3  CG13344-RA, transcript variant A (CG13344), mRNA 
0   NM_143054.2  CG11168-RA (CG11168), mRNA 
0   NM_170027.2  CG31158-RA, transcript variant A (CG31158), mRNA 
0   NM_176541.1  CG31158-RB, transcript variant B (CG31158), mRNA 
0   NM_205886.1  CG11838-RB, transcript variant B (Oseg3), mRNA 
0   NM_134686.1  CG11838-RA, transcript variant A (Oseg3), mRNA 
0   12  NM_078616.3  CG10524-RA (Pkcdelta), mRNA 
0   10  NM_168217.2  CG7546-RB, transcript variant B (CG7546), mRNA 
0   10  NM_139875.3  CG7546-RA, transcript variant A (CG7546), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.