National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6518R-1 
 Symbol inaC  Full Name inactivation no afterpotential C 
 CG No CG6518  Old CG No CG6518 
 Synonyms InaC, PKC, INAC, CG6518, eye PKC, PKCi, eye-PKC, PKC 53E, ePKC, unnamed, dPKC53E(ey), Dpkc2, pkc-2, dPKC53E, Pkc2, inaC 
 Accession No (Link to NCBI) NM_057515.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCTGGCAAAGGTCCAGGAAATCTACTGGAGATCACTGGCGAAGCAAATATCGTCAACTAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATGAAGAATCGTCTAAGGAAGGGTGCGATGAAGCGAAAGGGTCTCGAAATGGTCAATGGT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CATCGTTTCGGAGTTAGATTCTTTAAGAATCCAACCTACTGCGGTCATTGCAAGGATTTC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATCTGGGGCTTTGGCAAGCAAGGTTTTCAGTGCGAGGAATGCCGCTTCAACATTCACCAG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||  | silico     241 AAGTGCTGTAAATTTGTGGTGTTCAAATGTCCTGGCAAGGACACGGACTTCGATGCCGAC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGCGCTAAGGTGAAGCACGGCTGGATTTCCACCACCTACACCACACCGACATTCTGCGAC 360

                          ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| silico     361 GAGTGCGGACTGCTGCTCCATGG-AGTCGCCCATCAGGGCGTCAAGTGCGAGAATTGCAA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCTAAATGTGCATCACGCCTGCCAGGAGACAGTGCCACCGATGTGTGGTGCGGACATCAG 480

6518R-1.IR_full       481 CGAGGTGAGGGGTAAACTACT 501
                          ||||||||||||||||||||| silico     481 CGAGGTGAGGGGTAAACTACT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057515.2  CG6518-RA (inaC), mRNA 
0.2   NM_165347.1  CG31675-RA (CG31675), mRNA 
0   NM_140175.2  CG6297-RB, transcript variant B (JIL-1), mRNA 
0   NM_168439.1  CG6297-RA, transcript variant A (JIL-1), mRNA 
0   NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_167189.2  CG32705-RA (CG32705), mRNA 
0   NM_142401.2  CG17806-RA (CG17806), mRNA 
0   NM_140308.2  CG4300-RB, transcript variant B (CG4300), mRNA 
0   NM_168496.1  CG4300-RA, transcript variant A (CG4300), mRNA 
0   NM_143409.1  CG11873-RA (CG11873), mRNA 
0   NM_169985.1  CG31465-RA (CG31465), mRNA 
0   15  19  NM_057334.2  CG6622-RA, transcript variant A (Pkc53E), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   NM_139624.2  CG11586-RA (CG11586), mRNA 
0   17  NM_166201.1  CG6622-RB, transcript variant B (Pkc53E), mRNA 
0   NM_001014453.1  CG33526-RD, transcript variant D (PNUTS), mRNA 
0   NM_141571.2  CG8223-RA (CG8223), mRNA 
0   NM_001043031.1  CG17800-RP, transcript variant P (Dscam), mRNA 
0   NM_206047.1  CG17800-RE, transcript variant E (Dscam), mRNA 
0   NM_001032245.1  CG13344-RB, transcript variant B (CG13344), mRNA 
0   NM_137071.3  CG13344-RA, transcript variant A (CG13344), mRNA 
0   NM_143054.2  CG11168-RA (CG11168), mRNA 
0   NM_170027.2  CG31158-RA, transcript variant A (CG31158), mRNA 
0   NM_176541.1  CG31158-RB, transcript variant B (CG31158), mRNA 
0   NM_205886.1  CG11838-RB, transcript variant B (Oseg3), mRNA 
0   NM_134686.1  CG11838-RA, transcript variant A (Oseg3), mRNA 
0   12  NM_078616.3  CG10524-RA (Pkcdelta), mRNA 
0   10  NM_168217.2  CG7546-RB, transcript variant B (CG7546), mRNA 
0   10  NM_139875.3  CG7546-RA, transcript variant A (CG7546), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.