National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6497R-3 
 Symbol CG6497  Full Name CG6497 
 CG No CG6497  Old CG No CG6497 
 Synonyms CG6497 
 Accession No (Link to NCBI) NM_140706.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAGCTGTGGCAGAAGCTACG 
 Primer Seq. 3'
aatctagaggtaccGGATCTCGCTCTCATTCGGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGAGCTGTGG CAGAAGCTAC GAGTGCAGTT TAATGACTTC TTCCACGCGA ACTACCCGTA 
0061 CATAGCGCTC TACAGCGGAC TGGGCGTGGC AGTAACAGCC TACTTGCACT ACCAATGGAG 
0121 CGTGCACCAC TACGACCTCA TGTACTGGAA GCGTTTGGCG GAGGTCTTCT CGCAGGACAT 
0181 CGACTGCATC CAGCTGGCTA TACTGCTCTT GATCTTCGCG ATCAACGCCA TTTTCGTATT 
0241 CATCATCCTG AGCGTCTATC TGCGCCCAGC CCTCGACAAT GGCAGTGAGA TGTCCTTGCT 
0301 GGAGATCAAG GATCGCTATG CCCGGTTCAT ACTGCTCCGC CTGATAGCCC GTCTCGATCG 
0361 CATACAGTCG AAGATCTCAG CGAGGCGTAA GAGCCTCACC TTCCAGCACT ATGTGAGGGC 
0421 ACACACGAAC ATGGTAAAGG CGGTGGCCGT GTTCCGCAAG GATGCACGCA AGCTAATCCT 
0481 GCCGAATGAG AGCGAGATCC  
 in silico PCR Fragment
0001 GGAGCTGTGG CAGAAGCTAC GAGTGCAGTT TAATGACTTC TTCCACGCGA ACTACCCGTA 
0061 CATAGCGCTC TACAGCGGAC TGGGCGTGGC AGTAACAGCC TACTTGCACT ACCAATGGAG 
0121 CGTGCACCAC TACGACCTCA TGTACTGGAA GCGTTTGGCG GAGGTCTTCT CGCAGGACAT 
0181 CGACTGCATC CAGCTGGCTA TACTGCTCTT GATCTTCGCG ATCAACGCCA TTTTCGTATT 
0241 CATCATCCTG AGCGTCTATC TGCGCCCAGC CCTCGACAAT GGCAGTGAGA TGTCCTTGCT 
0301 GGAGATCAAG GATCGCTATG CCCGGTTCAT ACTGCTCCGC CTGATAGCCC GTCTCGATCG 
0361 CATACAGTCG AAGATCTCAG CGAAGCGTAA GAGCCTCACC TTCCAGCACT ATGTGAGGGC 
0421 ACACACGAAC ATGGTAAAGG CGGTGGCCGT GTTCCGCAAG GATGCACGCA AGCTAATCCT 
0481 GCCGAATGAG AGCGAGATCC  
 Assemble Data

6497R-3.IR_full       1   GGAGCTGTGGCAGAAGCTACGAGTGCAGTTTAATGACTTCTTCCACGCGAACTACCCGTA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6497R-3.in silico     1   GGAGCTGTGGCAGAAGCTACGAGTGCAGTTTAATGACTTCTTCCACGCGAACTACCCGTA 60


6497R-3.IR_full       61  CATAGCGCTCTACAGCGGACTGGGCGTGGCAGTAACAGCCTACTTGCACTACCAATGGAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6497R-3.in silico     61  CATAGCGCTCTACAGCGGACTGGGCGTGGCAGTAACAGCCTACTTGCACTACCAATGGAG 120


6497R-3.IR_full       121 CGTGCACCACTACGACCTCATGTACTGGAAGCGTTTGGCGGAGGTCTTCTCGCAGGACAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6497R-3.in silico     121 CGTGCACCACTACGACCTCATGTACTGGAAGCGTTTGGCGGAGGTCTTCTCGCAGGACAT 180


6497R-3.IR_full       181 CGACTGCATCCAGCTGGCTATACTGCTCTTGATCTTCGCGATCAACGCCATTTTCGTATT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6497R-3.in silico     181 CGACTGCATCCAGCTGGCTATACTGCTCTTGATCTTCGCGATCAACGCCATTTTCGTATT 240


6497R-3.IR_full       241 CATCATCCTGAGCGTCTATCTGCGCCCAGCCCTCGACAATGGCAGTGAGATGTCCTTGCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6497R-3.in silico     241 CATCATCCTGAGCGTCTATCTGCGCCCAGCCCTCGACAATGGCAGTGAGATGTCCTTGCT 300


6497R-3.IR_full       301 GGAGATCAAGGATCGCTATGCCCGGTTCATACTGCTCCGCCTGATAGCCCGTCTCGATCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6497R-3.in silico     301 GGAGATCAAGGATCGCTATGCCCGGTTCATACTGCTCCGCCTGATAGCCCGTCTCGATCG 360


6497R-3.IR_full       361 CATACAGTCGAAGATCTCAGCGAGGCGTAAGAGCCTCACCTTCCAGCACTATGTGAGGGC 420
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
6497R-3.in silico     361 CATACAGTCGAAGATCTCAGCGAAGCGTAAGAGCCTCACCTTCCAGCACTATGTGAGGGC 420


6497R-3.IR_full       421 ACACACGAACATGGTAAAGGCGGTGGCCGTGTTCCGCAAGGATGCACGCAAGCTAATCCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6497R-3.in silico     421 ACACACGAACATGGTAAAGGCGGTGGCCGTGTTCCGCAAGGATGCACGCAAGCTAATCCT 480


6497R-3.IR_full       481 GCCGAATGAGAGCGAGATCC 500
                          ||||||||||||||||||||
6497R-3.in silico     481 GCCGAATGAGAGCGAGATCC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140706.1  CG6497-RA (CG6497), mRNA 
0   NM_142914.2  CG10252-RA (CG10252), mRNA 
0   NM_136179.1  CG10721-RA (CG10721), mRNA 
0   NM_136965.3  CG8772-RF, transcript variant F (nemy), mRNA 
0   NM_165938.1  CG8772-RA, transcript variant A (nemy), mRNA 
0   NM_165939.1  CG8772-RD, transcript variant D (nemy), mRNA 
0   NM_165941.1  CG8772-RE, transcript variant E (nemy), mRNA 
0   NM_165942.1  CG8772-RC, transcript variant C (nemy), mRNA 
0   NM_165943.1  CG8772-RB, transcript variant B (nemy), mRNA 
0   NM_140430.2  CG6603-RA, transcript variant A (Hsc70Cb), mRNA 
0   NM_168573.1  CG6603-RB, transcript variant B (Hsc70Cb), mRNA 
0   NM_168574.1  CG6603-RC, transcript variant C (Hsc70Cb), mRNA 
0   NM_206496.1  CG14869-RB, transcript variant B (CG14869), mRNA 
0   NM_169659.2  CG14869-RA, transcript variant A (CG14869), mRNA 
0   NM_138250.2  CG9149-RA (CG9149), mRNA 
0   NM_141237.1  CG14655-RA (CG14655), mRNA 
0   NM_169384.2  CG31386-RA (CG31386), mRNA 
0   NM_079471.2  CG18023-RA, transcript variant A (Eip78C), mRNA 
0   NM_168892.1  CG18023-RB, transcript variant B (Eip78C), mRNA 
0   NM_206413.1  CG18023-RC, transcript variant C (Eip78C), mRNA 
0   NM_170110.2  CG5405-RC, transcript variant C (KrT95D), mRNA 
0   NM_170108.2  CG5405-RB, transcript variant B (KrT95D), mRNA 
0   NM_001043139.1  CG11282-RC, transcript variant C (caps), mRNA 
0   NM_079749.4  CG5405-RA, transcript variant A (KrT95D), mRNA 
0   NM_169199.1  CG17816-RA, transcript variant A (CG17816), mRNA 
0   NM_206458.2  CG17816-RD, transcript variant D (CG17816), mRNA 
0   NM_169198.1  CG17816-RB, transcript variant B (CG17816), mRNA 
0   NM_141487.2  CG17816-RC, transcript variant C (CG17816), mRNA 
0   NM_135440.1  CG4450-RA (CG4450), mRNA 
0   NM_079992.3  CG17976-RA (sut3), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.