National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6494R-1 
 Symbol Full Name hairy 
 CG No CG6494  Old CG No CG6494 
 Synonyms Hairy, CG6494, dDr1, 8247, l(3)08247, brr, l(3)rM384, h 
 Accession No (Link to NCBI) NM_079253.3 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAAGTGACCGTCGGTCGAACA 
 Primer Seq. 3'
aatctagaggtaccAAAGTAACCGCTGGCCGTCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAAGTGACCG TCGGTCGAAC AAGCCCATCA TGGAGAAACG CCGACGTGCC CGTATTAACA 
0061 ACTGTCTCAA TGAACTCAAG ACTCTGATTC TGGATGCCAC CAAAAAAAGA CCCGGCTCGC 
0121 CACTCCAAAT TGGAAAAGGC CGACATTCTG GAGAAGACAG TAAAGCATCT GCAGGANGCT 
0181 GCAGCGCCAG CAGGCAGCCA TGCAGCAGGC CGCCGATCCC AAGATTGTGA ACAAATTCAA 
0241 GGCCGGATTC GCCGACTGTG TGAACGAGGT TAGCCGCTTT CCCGGCATCG AGCCCGCCCA 
0301 GCGTCGTCGC CTGCTACAGC ACCTGAGCAA CTGCATCAAT GGCGTTAAGA CAGAGCTGCA 
0361 CCAGCNAGCA GCGCCAGCAG CAAACAGCAG TCCATCCACG CCCAGATGCT GCCCTCGCCG 
0421 CCCAGCTCGC CGGAGCAGGN ATAGCCAGCA GGGAGCAGCG GCACCCTACC TCTTTGGTAT 
0481 CCAGCANGAN GGCCAGCGGT TACTTT 
 in silico PCR Fragment
0001 AAAGTGACCG TCGGTCGAAC AAGCCCATCA TGGAGAAACG CCGACGTGCC CGTATTAACA 
0061 ACTGTCTCAA TGAACTCAAG ACTCTGATTC TGGATGCCAC C-AAAAAAGA CCCGGCTCGC 
0121 CACTCCAAAT TGGAAAAGGC CGACATTCTG GAGAAGACAG TAAAGCATCT GCAGGA-GCT 
0181 GCAGCGCCAG CAGGCAGCCA TGCAGCAGGC CGCCGATCCC AAGATTGTGA ACAAATTCAA 
0241 GGCCGGATTC GCCGACTGTG TGAACGAGGT TAGCCGCTTT CCCGGCATCG AGCCCGCCCA 
0301 GCGTCGTCGC CTGCTACAGC ACCTGAGCAA CTGCATCAAT GGCGTTAAGA CAGAGCTGCA 
0361 CCAGC-AGCA GCGCCAGCAG C-AACAGCAG TCCATCCACG CCCAGATGCT GCCCTCGCCG 
0421 CCCAGCTCGC CGGAGCAGG- ATAGCCAGCA GGGAGCAGCG GCACCCTACC TCTTTGGTAT 
0481 CCAGCA-GAC GGCCAGCGGT TACTTT 
 Assemble Data

6494R-1.IR_full       1   AAAGTGACCGTCGGTCGAACAAGCCCATCATGGAGAAACGCCGACGTGCCCGTATTAACA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6494R-1.in silico     1   AAAGTGACCGTCGGTCGAACAAGCCCATCATGGAGAAACGCCGACGTGCCCGTATTAACA 60


6494R-1.IR_full       61  ACTGTCTCAATGAACTCAAGACTCTGATTCTGGATGCCACCAAAAAAAGACCCGGCTCGC 120
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
6494R-1.in silico     61  ACTGTCTCAATGAACTCAAGACTCTGATTCTGGATGCCACC-AAAAAAGACCCGGCTCGC 120


6494R-1.IR_full       121 CACTCCAAATTGGAAAAGGCCGACATTCTGGAGAAGACAGTAAAGCATCTGCAGGANGCT 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
6494R-1.in silico     121 CACTCCAAATTGGAAAAGGCCGACATTCTGGAGAAGACAGTAAAGCATCTGCAGGA-GCT 180


6494R-1.IR_full       181 GCAGCGCCAGCAGGCAGCCATGCAGCAGGCCGCCGATCCCAAGATTGTGAACAAATTCAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6494R-1.in silico     181 GCAGCGCCAGCAGGCAGCCATGCAGCAGGCCGCCGATCCCAAGATTGTGAACAAATTCAA 240


6494R-1.IR_full       241 GGCCGGATTCGCCGACTGTGTGAACGAGGTTAGCCGCTTTCCCGGCATCGAGCCCGCCCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6494R-1.in silico     241 GGCCGGATTCGCCGACTGTGTGAACGAGGTTAGCCGCTTTCCCGGCATCGAGCCCGCCCA 300


6494R-1.IR_full       301 GCGTCGTCGCCTGCTACAGCACCTGAGCAACTGCATCAATGGCGTTAAGACAGAGCTGCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6494R-1.in silico     301 GCGTCGTCGCCTGCTACAGCACCTGAGCAACTGCATCAATGGCGTTAAGACAGAGCTGCA 360


6494R-1.IR_full       361 CCAGCNAGCAGCGCCAGCAGCAAACAGCAGTCCATCCACGCCCAGATGCTGCCCTCGCCG 420
                          ||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||
6494R-1.in silico     361 CCAGC-AGCAGCGCCAGCAGC-AACAGCAGTCCATCCACGCCCAGATGCTGCCCTCGCCG 420


6494R-1.IR_full       421 CCCAGCTCGCCGGAGCAGGNATAGCCAGCAGGGAGCAGCGGCACCCTACCTCTTTGGTAT 480
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
6494R-1.in silico     421 CCCAGCTCGCCGGAGCAGG-ATAGCCAGCAGGGAGCAGCGGCACCCTACCTCTTTGGTAT 480


6494R-1.IR_full       481 CCAGCANGANGGCCAGCGGTTACTTT 506
                          |||||| || ||||||||||||||||
6494R-1.in silico     481 CCAGCA-GACGGCCAGCGGTTACTTT 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  49  NM_001014577.1  CG6494-RB, transcript variant B (h), mRNA 
100   482  49  NM_079253.3  CG6494-RA, transcript variant A (h), mRNA 
0.62   10  12  NM_136735.2  CG12901-RA, transcript variant A (CG12901), mRNA 
0.41   21  104  NM_167330.2  CG17762-RD, transcript variant D (tomosyn), mRNA 
0.41   14  30  NM_136857.2  CG12443-RA (ths), mRNA 
0.41   12  47  NM_167329.2  CG17762-RC, transcript variant C (tomosyn), mRNA 
0.41   12  47  NM_167328.2  CG17762-RA, transcript variant A (tomosyn), mRNA 
0.41   10  15  NM_132591.3  CG17762-RB, transcript variant B (tomosyn), mRNA 
0.41   14  NM_206493.1  CG33485-RA (dpr9), mRNA 
0.2   35  NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 
0.2   34  NM_167347.1  CG4353-RB, transcript variant B (hep), mRNA 
0.2   NM_164618.1  CG14041-RA, transcript variant A (SP555), mRNA 
0.2   NM_144359.2  CG14041-RB, transcript variant B (SP555), mRNA 
0.2   NM_001042871.1  CG14042-RA, transcript variant A (CG14042), mRNA 
0.2   NM_001042872.1  CG14042-RB, transcript variant B (CG14042), mRNA 
0.2   30  NM_176723.2  CG33175-RG, transcript variant G (spri), mRNA 
0.2   21  NM_206678.1  CG33175-RA, transcript variant A (spri), mRNA 
0.2   14  NM_132581.1  CG11138-RC, transcript variant C (CG11138), mRNA 
0.2   13  NM_176724.1  CG33175-RH, transcript variant H (spri), mRNA 
0   49  206  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0   49  206  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0   34  151  NM_170478.1  CG15532-RB, transcript variant B (hdc), mRNA 
0   10  70  NM_164960.1  CG32830-RA (CG32830), mRNA 
0   67  NM_001038952.1  CG33975-RA (CG33975), mRNA 
0   10  NM_167369.1  CG1640-RF, transcript variant F (CG1640), mRNA 
0   NM_132651.2  CG1640-RA, transcript variant A (CG1640), mRNA 
0   NM_167368.1  CG1640-RE, transcript variant E (CG1640), mRNA 
0   NM_167367.1  CG1640-RD, transcript variant D (CG1640), mRNA 
0   NM_167366.1  CG1640-RC, transcript variant C (CG1640), mRNA 
0   NM_167365.1  CG1640-RB, transcript variant B (CG1640), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.