National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6483R-1 
 Symbol Jon65Aiii  Full Name Jonah 65Aiii 
 CG No CG6483  Old CG No CG6483 
 Synonyms CG6483, Jon65A, SP98, anon-EST:GressD16, anon-WO0140519.59, Jon65Aiii 
 Accession No (Link to NCBI) NM_139756.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGAAAGTGCTCGTAGTCTTCG 
 Primer Seq. 3'
aatctagaggtaccATGGCGGGCAGCTCAACCTTG 
 Predicted Fragment Size
451 
 IR fragment full Seq
0001 TGAAAGTGCT CGTAGTCTTC GCCCTGGcTC TGGCCACCGC CTCCGCCGGT NCTGCTGCCC 
0061 CAGCAGGTGC CGATCCACCC CCGTGACCTG CCCGCCGTGA CCAATATCGA GGGTCGCATC 
0121 ACCAACGGCA AGACCGCCAC TTCTGGCCAG TTCCCCTACC AGGTGGGACT NCAGCTTCGC 
0181 CAGCACCAGC GGCAGCTGGT GGTGCGGNTG GTTCCATCAT CGACAACACC TGGGTTCTCA 
0241 CTGCTGCTCA CTGCACTTNC TGGTGCCTCC GCTGTGACCA TTTACTACGG AGCCACCGTG 
0301 CGTACTAGTG CCCAGCTGGT CCAGACCGTT TCCGCCGATA ACTTCGTTCA GCACGCCAGC 
0361 TACAACTCGA TTGTGTTGAG GAACGACATT TCCCTGATCA AGACCCCAAC GGTTGCCTTC 
0421 ACCGCCCTTA TTAACAAGGT TGAGCTGCCC GCCAT 
 in silico PCR Fragment
0001 TGAAAGTGCT CGTAGTCTTC GCCCTGGCTC TGGCCACCGC CTCCGCCGGT -CTGCTGCCC 
0061 CAGCAGGTGC CGATCCACCC CCGTGACCTG CCCGCCGTGA CCAATATCGA GGGTCGCATC 
0121 ACCAACGGCA AGACCGCCAC TTCTGGCCAG TTCCCCTACC AGGTGGGACT -CAGCTTCGC 
0181 CAGCACCAGC GGCAGCTGGT GGTGCGG-TG GTTCCATCAT CGACAACACC TGGGTTCTCA 
0241 CTGCTGCTCA CTGCACTT-C TGGTGCCTCC GCTGTGACCA TTTACTACGG AGCCACCGTG 
0301 CGTACTAGTG CCCAGCTGGT CCAGACCGTT TCCGCCGATA ACTTCGTTCA GCACGCCAGC 
0361 TACAACTCGA TTGTGTTGAG GAACGACATT TCCCTGATCA AGACCCCAAC GGTTGCCTTC 
0421 ACCGCCCTTA TTAACAAGGT TGAGCTGCCC GCCAT 
 Assemble Data

6483R-1.IR_full       1   TGAAAGTGCTCGTAGTCTTCGCCCTGGCTCTGGCCACCGCCTCCGCCGGTNCTGCTGCCC 60
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
6483R-1.in silico     1   TGAAAGTGCTCGTAGTCTTCGCCCTGGCTCTGGCCACCGCCTCCGCCGGT-CTGCTGCCC 60


6483R-1.IR_full       61  CAGCAGGTGCCGATCCACCCCCGTGACCTGCCCGCCGTGACCAATATCGAGGGTCGCATC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6483R-1.in silico     61  CAGCAGGTGCCGATCCACCCCCGTGACCTGCCCGCCGTGACCAATATCGAGGGTCGCATC 120


6483R-1.IR_full       121 ACCAACGGCAAGACCGCCACTTCTGGCCAGTTCCCCTACCAGGTGGGACTNCAGCTTCGC 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
6483R-1.in silico     121 ACCAACGGCAAGACCGCCACTTCTGGCCAGTTCCCCTACCAGGTGGGACT-CAGCTTCGC 180


6483R-1.IR_full       181 CAGCACCAGCGGCAGCTGGTGGTGCGGNTGGTTCCATCATCGACAACACCTGGGTTCTCA 240
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
6483R-1.in silico     181 CAGCACCAGCGGCAGCTGGTGGTGCGG-TGGTTCCATCATCGACAACACCTGGGTTCTCA 240


6483R-1.IR_full       241 CTGCTGCTCACTGCACTTNCTGGTGCCTCCGCTGTGACCATTTACTACGGAGCCACCGTG 300
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
6483R-1.in silico     241 CTGCTGCTCACTGCACTT-CTGGTGCCTCCGCTGTGACCATTTACTACGGAGCCACCGTG 300


6483R-1.IR_full       301 CGTACTAGTGCCCAGCTGGTCCAGACCGTTTCCGCCGATAACTTCGTTCAGCACGCCAGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6483R-1.in silico     301 CGTACTAGTGCCCAGCTGGTCCAGACCGTTTCCGCCGATAACTTCGTTCAGCACGCCAGC 360


6483R-1.IR_full       361 TACAACTCGATTGTGTTGAGGAACGACATTTCCCTGATCAAGACCCCAACGGTTGCCTTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6483R-1.in silico     361 TACAACTCGATTGTGTTGAGGAACGACATTTCCCTGATCAAGACCCCAACGGTTGCCTTC 420


6483R-1.IR_full       421 ACCGCCCTTATTAACAAGGTTGAGCTGCCCGCCAT 455
                          |||||||||||||||||||||||||||||||||||
6483R-1.in silico     421 ACCGCCCTTATTAACAAGGTTGAGCTGCCCGCCAT 455

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   433  NM_139756.2  CG6483-RA (Jon65Aiii), mRNA 
2.54   11  21  42  53  NM_079220.1  CG6457-RA (yip7), mRNA 
2.07   12  NM_139760.1  CG10472-RA (CG10472), mRNA 
1.84   39  NM_139755.2  CG6467-RA (Jon65Aiv), mRNA 
1.38   21  12  13  NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
0.69   19  14  NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
0.46   22  21  37  NM_139753.1  CG10477-RA (CG10477), mRNA 
0.46   32  35  NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
0.46   32  33  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0.23   23  19  16  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
0.23   23  19  16  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
0.23   NM_136864.2  CG13185-RA (CG13185), mRNA 
0.23   NM_165582.1  CG8722-RB, transcript variant B (Nup44A), mRNA 
0.23   NM_165583.1  CG8722-RC, transcript variant C (Nup44A), mRNA 
0.23   NM_136499.2  CG8722-RA, transcript variant A (Nup44A), mRNA 
0   16  15  16  NM_165618.1  CG8579-RA (Jon44E), mRNA 
0   11  13  17  NM_135037.1  CG8871-RA (Jon25Biii), mRNA 
0   25  28  NM_135038.1  CG8869-RA (Jon25Bii), mRNA 
0   30  32  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0   10  NM_135651.2  CG4751-RA (CG4751), mRNA 
0   15  17  NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
0   NM_140096.3  CG18177-RB, transcript variant B (CG18177), mRNA 
0   NM_206310.1  CG18177-RA, transcript variant A (CG18177), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_136732.1  CG12904-RA (CG12904), mRNA 
0   NM_130552.2  CG3056-RA, transcript variant A (CG3056), mRNA 
0   NM_206603.1  CG3056-RB, transcript variant B (CG3056), mRNA 
0   29  28  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0   11  15  NM_139757.1  CG6580-RA (Jon65Aii), mRNA 
0   10  NM_141666.2  CG9492-RA (CG9492), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.