National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6463R-2 
 Symbol CG6463  Full Name CG6463 
 CG No CG6463  Old CG No CG6463 
 Synonyms BcDNA:RH11203, CG6463 
 Accession No (Link to NCBI) NM_140152.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGCCAAGATCATTAAGGCGTCCACAGGTTTGACTGGACTCGCCGTGTCCACCAATCCA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CACCACACGCTGAGTGCTCTGTATGGCAAGATTCTGCGGGCGGTGTCCAAGATGCCACAG 120

                          ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GACGC-CAGCTACCGCAAGTACACGGAGCAACTGGTCAAGCAGCGCGCCGATTCTGTGGC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCAACACAAGGACATCACTGCCCTGGAAAAGGCCGTCGGTTGCGGTCAAGTGGAGGAGCT 240

                          |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| silico     241 AATTGTCCAGGCCGAGAACGAGCTGATCCTTGCGCGCAAAATGCTCGGCTGGAAGCCCTG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGAGAAGTTGGTCCAAGCCGCGCCTGCCAAGCAGTGGGACTGGCCACCAGCCCAGATCAT 360

6463R-2.IR_full       361 GGAGCCCAAGGTT 373
                          ||||||||||||| silico     361 GGAGCCCAAGGTT 373

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   354  NM_140152.1  CG6463-RA (CG6463), mRNA 
0.84   NM_169073.1  CG1088-RA, transcript variant A (Vha26), mRNA 
0.84   NM_079513.2  CG1088-RB, transcript variant B (Vha26), mRNA 
0.28   NM_057943.3  CG12249-RA, transcript variant A (mira), mRNA 
0.28   NM_057944.3  CG12249-RB, transcript variant B (mira), mRNA 
0   NM_142538.1  CG5237-RA (CG5237), mRNA 
0   NM_141731.1  CG3996-RA (CG3996), mRNA 
0   NM_078876.4  CG10697-RA, transcript variant A (Ddc), mRNA 
0   NM_165279.1  CG10697-RC, transcript variant C (Ddc), mRNA 
0   NM_165280.1  CG10697-RB, transcript variant B (Ddc), mRNA 
0   NM_164597.1  CG15626-RB, transcript variant B (CG15626), mRNA 
0   NM_135020.2  CG15626-RA, transcript variant A (CG15626), mRNA 
0   NM_057388.2  CG9224-RA (sog), mRNA 
0   NM_176544.1  CG33193-RA (sav), mRNA 
0   NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_057910.3  CG4472-RA (Idgf1), mRNA 
0   NM_079953.3  CG10776-RA (wit), mRNA 
0   NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
0   NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
0   NM_078649.2  CG9842-RA (Pp2B-14D), mRNA 
0   NM_079643.1  CG5178-RA (Act88F), mRNA 
0   NM_141139.1  CG12377-RA (CG12377), mRNA 
0   NM_136500.2  CG11196-RA (CG11196), mRNA 
0   NM_176333.1  CG5444-RC, transcript variant C (Taf4), mRNA 
0   NM_079378.2  CG5444-RA, transcript variant A (Taf4), mRNA 
0   NM_206379.1  CG5444-RD, transcript variant D (Taf4), mRNA 
0   NM_168651.1  CG5444-RB, transcript variant B (Taf4), mRNA 
0   NM_138092.1  CG3522-RA, transcript variant A (Start1), mRNA 
0   NM_206217.1  CG3522-RB, transcript variant B (Start1), mRNA 
0   NM_144464.1  CG18508-RA (CG18508), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.