National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6463R-1 
 Symbol CG6463  Full Name CG6463 
 CG No CG6463  Old CG No CG6463 
 Synonyms BcDNA:RH11203, CG6463 
 Accession No (Link to NCBI) NM_140152.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Garcia CJ, Khajeh J, Coulanges E, Chen EI, Owusu-Ansah E.
Regulation of Mitochondrial Complex I Biogenesis in Drosophila Flight Muscles.
Cell Rep (2017) 20(1) 264-278 [ PubMed ID = 28683319 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCCAAGATCATTAAGGCG 
 Primer Seq. 3'
aatctagaggtaccAACCTTGGGCTCCATGATCTG 
 Predicted Fragment Size
372 
 IR fragment full Seq
0001 ATGGCCAAGA TCATTAAGGC GTCCACAGGT TTGACTGGAC TCGCCGTGTC CACCAATCCA 
0061 CACCACACGC TGAGTGCTCT GTATGGCAAG ATTCTGCGGG CGGTGTCCAA GATGCCACAG 
0121 GACGCNCAGC TACCGCAAGT ACACGGAGCA ACTGGTCAAG CAGCGCGCCG ATTCTGTGGC 
0181 CCAACACAAG GACATCACTG CCCTGGAAAA GGCCGTCGGT TGCGGTCAAG TGGAGGAGCT 
0241 AATTGTCCAG GCCGAGAACG AGCTGATCCT GGCGCGCAAA ATGCTCGGCT GGAAGCCCTG 
0301 GGAGAAGTTG GTCCAAGCCG CGCCTGCCAA GCAGTGGGAC TGGCCACCAG CCCAGATCAT 
0361 GGAGCCCAAG GTT 
 in silico PCR Fragment
0001 ATGGCCAAGA TCATTAAGGC GTCCACAGGT TTGACTGGAC TCGCCGTGTC CACCAATCCA 
0061 CACCACACGC TGAGTGCTCT GTATGGCAAG ATTCTGCGGG CGGTGTCCAA GATGCCACAG 
0121 GACGC-CAGC TACCGCAAGT ACACGGAGCA ACTGGTCAAG CAGCGCGCCG ATTCTGTGGC 
0181 CCAACACAAG GACATCACTG CCCTGGAAAA GGCCGTCGGT TGCGGTCAAG TGGAGGAGCT 
0241 AATTGTCCAG GCCGAGAACG AGCTGATCCT TGCGCGCAAA ATGCTCGGCT GGAAGCCCTG 
0301 GGAGAAGTTG GTCCAAGCCG CGCCTGCCAA GCAGTGGGAC TGGCCACCAG CCCAGATCAT 
0361 GGAGCCCAAG GTT 
 Assemble Data

6463R-1.IR_full       1   ATGGCCAAGATCATTAAGGCGTCCACAGGTTTGACTGGACTCGCCGTGTCCACCAATCCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6463R-1.in silico     1   ATGGCCAAGATCATTAAGGCGTCCACAGGTTTGACTGGACTCGCCGTGTCCACCAATCCA 60


6463R-1.IR_full       61  CACCACACGCTGAGTGCTCTGTATGGCAAGATTCTGCGGGCGGTGTCCAAGATGCCACAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6463R-1.in silico     61  CACCACACGCTGAGTGCTCTGTATGGCAAGATTCTGCGGGCGGTGTCCAAGATGCCACAG 120


6463R-1.IR_full       121 GACGCNCAGCTACCGCAAGTACACGGAGCAACTGGTCAAGCAGCGCGCCGATTCTGTGGC 180
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
6463R-1.in silico     121 GACGC-CAGCTACCGCAAGTACACGGAGCAACTGGTCAAGCAGCGCGCCGATTCTGTGGC 180


6463R-1.IR_full       181 CCAACACAAGGACATCACTGCCCTGGAAAAGGCCGTCGGTTGCGGTCAAGTGGAGGAGCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6463R-1.in silico     181 CCAACACAAGGACATCACTGCCCTGGAAAAGGCCGTCGGTTGCGGTCAAGTGGAGGAGCT 240


6463R-1.IR_full       241 AATTGTCCAGGCCGAGAACGAGCTGATCCTGGCGCGCAAAATGCTCGGCTGGAAGCCCTG 300
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
6463R-1.in silico     241 AATTGTCCAGGCCGAGAACGAGCTGATCCTTGCGCGCAAAATGCTCGGCTGGAAGCCCTG 300


6463R-1.IR_full       301 GGAGAAGTTGGTCCAAGCCGCGCCTGCCAAGCAGTGGGACTGGCCACCAGCCCAGATCAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6463R-1.in silico     301 GGAGAAGTTGGTCCAAGCCGCGCCTGCCAAGCAGTGGGACTGGCCACCAGCCCAGATCAT 360


6463R-1.IR_full       361 GGAGCCCAAGGTT 373
                          |||||||||||||
6463R-1.in silico     361 GGAGCCCAAGGTT 373

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   354  NM_140152.1  CG6463-RA (CG6463), mRNA 
0.84   NM_169073.1  CG1088-RA, transcript variant A (Vha26), mRNA 
0.84   NM_079513.2  CG1088-RB, transcript variant B (Vha26), mRNA 
0.28   NM_057943.3  CG12249-RA, transcript variant A (mira), mRNA 
0.28   NM_057944.3  CG12249-RB, transcript variant B (mira), mRNA 
0   NM_142538.1  CG5237-RA (CG5237), mRNA 
0   NM_141731.1  CG3996-RA (CG3996), mRNA 
0   NM_078876.4  CG10697-RA, transcript variant A (Ddc), mRNA 
0   NM_165279.1  CG10697-RC, transcript variant C (Ddc), mRNA 
0   NM_165280.1  CG10697-RB, transcript variant B (Ddc), mRNA 
0   NM_164597.1  CG15626-RB, transcript variant B (CG15626), mRNA 
0   NM_135020.2  CG15626-RA, transcript variant A (CG15626), mRNA 
0   NM_057388.2  CG9224-RA (sog), mRNA 
0   NM_176544.1  CG33193-RA (sav), mRNA 
0   NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_057910.3  CG4472-RA (Idgf1), mRNA 
0   NM_079953.3  CG10776-RA (wit), mRNA 
0   NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
0   NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
0   NM_078649.2  CG9842-RA (Pp2B-14D), mRNA 
0   NM_079643.1  CG5178-RA (Act88F), mRNA 
0   NM_141139.1  CG12377-RA (CG12377), mRNA 
0   NM_136500.2  CG11196-RA (CG11196), mRNA 
0   NM_176333.1  CG5444-RC, transcript variant C (Taf4), mRNA 
0   NM_079378.2  CG5444-RA, transcript variant A (Taf4), mRNA 
0   NM_206379.1  CG5444-RD, transcript variant D (Taf4), mRNA 
0   NM_168651.1  CG5444-RB, transcript variant B (Taf4), mRNA 
0   NM_138092.1  CG3522-RA, transcript variant A (Start1), mRNA 
0   NM_206217.1  CG3522-RB, transcript variant B (Start1), mRNA 
0   NM_144464.1  CG18508-RA (CG18508), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.