National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6455R-2 
 Symbol CG6455  Full Name CG6455 
 CG No CG6455  Old CG No CG6455 
 Synonyms CG6455 
 Accession No (Link to NCBI) NM_079720.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTATCGGCTAGCGGTGCGA 
 Primer Seq. 3'
aatctagaggtaccTTGGACTTGTCATCGCCGCTG 
 Predicted Fragment Size
503 
 IR fragment full Seq
0001 NTGTATCGGC TAGCGGTGNG AGATCAGTGC AAGTGCGCCC TGCAGCgtNC NCNNCAgNAG 
0061 ACGACCGCAA ACAACAGGCA ATTCGGCGGA AGCAGCAGCG GTAAGTGGCG GCCGGGACCA 
0121 GGGCAGGCGG CAGCAGGAGG AGCAGGGACA GCAAGGCGAT CAAGGATATC AAGGATACCA 
0181 GAGCCTGCCA NCCGCATATG CGCGAAGCTG TGCTTCGGCA AAGTGGTCCT CTTCGTCTCA 
0241 CCACTGGCAG CTGTCGGCGG TGTCATCACC TACGCCAAAT ACGACGACGA CTTCCGCAAA 
0301 TTGGTGGAGA AGAATGTACC CGGCGCAGGA TCCGTCATCA AGGTGGCTCT GCAGGAGGAA 
0361 CCGCCATTCA AGGGCATCAC CAAGAACGTC AACGATCAGA TCGATAAGGT CAAGTCTGGC 
0421 ATCGAGACAG TGACGTCCAC GGTGGACTCC GTTACATCTA AGGTGACGGG CCTGTTTGGC 
0481 GGCGGCAGCG GCGAATGACA AGTCCAA 
 in silico PCR Fragment
0001 ATGTATCGGC TAGCGGTGCG AGATCAGTGC AAGTGCGCCC TGCAGCGTAC GCTGCAGCAG 
0061 ACGACCGCAA ACAACAGGCA ATTCGGCGGA AGCAGCAGCG G-AAGTGGCG GCCGGGAACA 
0121 GGGCAGGCGG CAGCAGGAGG AGCAGGGACA GCAAGGCGAT CAAGGATATC AAGGATACCA 
0181 GAGCCTGCCA -CCGCATATG CGCGAAGCTG -GCTTCGGCA AAGTGGTCCT CTTCGTCTCA 
0241 CCACTGGCAG CTGTCGGCGG TGTCATCACC TACGCCAAAT ACGACGACGA CTTCCGCAAA 
0301 TTGGTGGAGA AGAATGTACC CGGCGCAGGA TCCGTCATCA AGGTGGCTCT GCAGGAGGAA 
0361 CCGCCATTCA AGGGCATCAC CAAGAACGTC AACGATCAGA TCGATAAGGT CAAGTCTGGC 
0421 ATCGAGACAG TGACGTCCAC GGTGGACTCC GTTACATCTA AGGTGACGGG CCTGTTTGGC 
0481 GGCGGCAGCG GCG-ATGACA AGTCCAA 
 Assemble Data

6455R-2.IR_full        1   TGTATCGGCTAGCGGTGNGAGATCAGTGCAAGTGCGCCCTGCAGCGTNCNCNNCAGNAG 59
                           ||||||||||||||||| ||||||||||||||||||||||||||||| | |  ||| ||
6455R-2.in silico      1   TGTATCGGCTAGCGGTGCGAGATCAGTGCAAGTGCGCCCTGCAGCGTACGCTGCAGCAG 59


6455R-2.IR_full       61  ACGACCGCAAACAACAGGCAATTCGGCGGAAGCAGCAGCGGTAAGTGGCGGCCGGGACCA 119
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||
6455R-2.in silico     61  ACGACCGCAAACAACAGGCAATTCGGCGGAAGCAGCAGCGG-AAGTGGCGGCCGGGAACA 119


6455R-2.IR_full       121 GGGCAGGCGGCAGCAGGAGGAGCAGGGACAGCAAGGCGATCAAGGATATCAAGGATACCA 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6455R-2.in silico     121 GGGCAGGCGGCAGCAGGAGGAGCAGGGACAGCAAGGCGATCAAGGATATCAAGGATACCA 179


6455R-2.IR_full       181 GAGCCTGCCANCCGCATATGCGCGAAGCTGTGCTTCGGCAAAGTGGTCCTCTTCGTCTCA 239
                          |||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||
6455R-2.in silico     181 GAGCCTGCCA-CCGCATATGCGCGAAGCTG-GCTTCGGCAAAGTGGTCCTCTTCGTCTCA 239


6455R-2.IR_full       241 CCACTGGCAGCTGTCGGCGGTGTCATCACCTACGCCAAATACGACGACGACTTCCGCAAA 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6455R-2.in silico     241 CCACTGGCAGCTGTCGGCGGTGTCATCACCTACGCCAAATACGACGACGACTTCCGCAAA 299


6455R-2.IR_full       301 TTGGTGGAGAAGAATGTACCCGGCGCAGGATCCGTCATCAAGGTGGCTCTGCAGGAGGAA 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6455R-2.in silico     301 TTGGTGGAGAAGAATGTACCCGGCGCAGGATCCGTCATCAAGGTGGCTCTGCAGGAGGAA 359


6455R-2.IR_full       361 CCGCCATTCAAGGGCATCACCAAGAACGTCAACGATCAGATCGATAAGGTCAAGTCTGGC 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6455R-2.in silico     361 CCGCCATTCAAGGGCATCACCAAGAACGTCAACGATCAGATCGATAAGGTCAAGTCTGGC 419


6455R-2.IR_full       421 ATCGAGACAGTGACGTCCACGGTGGACTCCGTTACATCTAAGGTGACGGGCCTGTTTGGC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6455R-2.in silico     421 ATCGAGACAGTGACGTCCACGGTGGACTCCGTTACATCTAAGGTGACGGGCCTGTTTGGC 479


6455R-2.IR_full       481 GGCGGCAGCGGCGAATGACAAGTCCAA 506
                          ||||||||||||| |||||||||||||
6455R-2.in silico     481 GGCGGCAGCGGCG-ATGACAAGTCCAA 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   485  NM_079720.2  CG6455-RA, transcript variant A (CG6455), mRNA 
32.98   160  NM_169988.1  CG6455-RB, transcript variant B (CG6455), mRNA 
0.2   NM_138043.3  CG3257-RA, transcript variant A (CG3257), mRNA 
0.2   NM_001038881.1  CG3257-RB, transcript variant B (CG3257), mRNA 
0.2   NM_079395.2  CG9695-RA (Dab), mRNA 
0   10  NM_133108.2  CG32542-RA (CG32542), mRNA 
0   NM_132159.1  CG1677-RA (CG1677), mRNA 
0   NM_057534.3  CG3242-RA (sob), mRNA 
0   23  NM_169790.1  CG7913-RA, transcript variant A (PP2A-B'), mRNA 
0   23  NM_169789.1  CG7913-RB, transcript variant B (PP2A-B'), mRNA 
0   NM_132320.2  CG12124-RA (CG12124), mRNA 
0   NM_141706.1  CG5358-RA (Art4), mRNA 
0   NM_169815.2  CG31122-RA (CG31122), mRNA 
0   22  NM_079996.2  CG18024-RA (SoxN), mRNA 
0   NM_132346.1  CG3003-RB (CG3003), mRNA 
0   NM_137112.1  CG13941-RA (CG13941), mRNA 
0   NM_140970.2  CG5199-RA (CG5199), mRNA 
0   NM_136845.1  CG9003-RA (CG9003), mRNA 
0   NM_169130.1  CG1148-RA, transcript variant A (Osi2), mRNA 
0   NM_141364.1  CG1148-RB, transcript variant B (Osi2), mRNA 
0   NM_132116.1  CG14441-RA (CG14441), mRNA 
0   13  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
0   31  NM_143745.2  CG18389-RA (Eip93F), mRNA 
0   24  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
0   10  NM_079117.2  CG3385-RA (nvy), mRNA 
0   NM_140285.2  CG32096-RD, transcript variant D (rols), mRNA 
0   NM_168490.1  CG32096-RE, transcript variant E (rols), mRNA 
0   NM_168487.1  CG32096-RB, transcript variant B (rols), mRNA 
0   NM_168488.1  CG32096-RA, transcript variant A (rols), mRNA 
0   NM_168489.1  CG32096-RC, transcript variant C (rols), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.