National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6455R-1 
 Symbol CG6455  Full Name CG6455 
 CG No CG6455  Old CG No CG6455 
 Synonyms CG6455 
 Accession No (Link to NCBI) NM_079720.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||| ||||||||||||||||||||||||||||| | |  ||| || silico      1   TGTATCGGCTAGCGGTGCGAGATCAGTGCAAGTGCGCCCTGCAGCGTACGCTGCAGCAG 59

                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || silico     61  ACGACCGCAAACAACAGGCAATTCGGCGGAAGCAGCAGCGG-AAGTGGCGGCCGGGAACA 119

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGGCAGGCGGCAGCAGGAGGAGCAGGGACAGCAAGGCGATCAAGGATATCAAGGATACCA 179

                          |||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| silico     181 GAGCCTGCCA-CCGCATATGCGCGAAGCTG-GCTTCGGCAAAGTGGTCCTCTTCGTCTCA 239

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCACTGGCAGCTGTCGGCGGTGTCATCACCTACGCCAAATACGACGACGACTTCCGCAAA 299

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTGGTGGAGAAGAATGTACCCGGCGCAGGATCCGTCATCAAGGTGGCTCTGCAGGAGGAA 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCGCCATTCAAGGGCATCACCAAGAACGTCAACGATCAGATCGATAAGGTCAAGTCTGGC 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATCGAGACAGTGACGTCCACGGTGGACTCCGTTACATCTAAGGTGACGGGCCTGTTTGGC 479

                          ||||||||||||| ||||||||||||| silico     481 GGCGGCAGCGGCG-ATGACAAGTCCAA 506

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   485  NM_079720.2  CG6455-RA, transcript variant A (CG6455), mRNA 
32.98   160  NM_169988.1  CG6455-RB, transcript variant B (CG6455), mRNA 
0.2   NM_138043.3  CG3257-RA, transcript variant A (CG3257), mRNA 
0.2   NM_001038881.1  CG3257-RB, transcript variant B (CG3257), mRNA 
0.2   NM_079395.2  CG9695-RA (Dab), mRNA 
0   10  NM_133108.2  CG32542-RA (CG32542), mRNA 
0   NM_132159.1  CG1677-RA (CG1677), mRNA 
0   NM_057534.3  CG3242-RA (sob), mRNA 
0   23  NM_169790.1  CG7913-RA, transcript variant A (PP2A-B'), mRNA 
0   23  NM_169789.1  CG7913-RB, transcript variant B (PP2A-B'), mRNA 
0   NM_132320.2  CG12124-RA (CG12124), mRNA 
0   NM_141706.1  CG5358-RA (Art4), mRNA 
0   NM_169815.2  CG31122-RA (CG31122), mRNA 
0   22  NM_079996.2  CG18024-RA (SoxN), mRNA 
0   NM_132346.1  CG3003-RB (CG3003), mRNA 
0   NM_137112.1  CG13941-RA (CG13941), mRNA 
0   NM_140970.2  CG5199-RA (CG5199), mRNA 
0   NM_136845.1  CG9003-RA (CG9003), mRNA 
0   NM_169130.1  CG1148-RA, transcript variant A (Osi2), mRNA 
0   NM_141364.1  CG1148-RB, transcript variant B (Osi2), mRNA 
0   NM_132116.1  CG14441-RA (CG14441), mRNA 
0   13  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
0   31  NM_143745.2  CG18389-RA (Eip93F), mRNA 
0   24  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
0   10  NM_079117.2  CG3385-RA (nvy), mRNA 
0   NM_140285.2  CG32096-RD, transcript variant D (rols), mRNA 
0   NM_168490.1  CG32096-RE, transcript variant E (rols), mRNA 
0   NM_168487.1  CG32096-RB, transcript variant B (rols), mRNA 
0   NM_168488.1  CG32096-RA, transcript variant A (rols), mRNA 
0   NM_168489.1  CG32096-RC, transcript variant C (rols), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.