National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6439R-1 
 Symbol CG6439  Full Name CG6439 
 CG No CG6439  Old CG No CG6439 
 Synonyms FBgn0038922, CG6439 
 Accession No (Link to NCBI) NM_142743.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGCTACGGGCTACGGATAACTACGGCGCCAACAGGACCACCTGCACACTGATTCCCGGCG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACGGTGTGGGTCCCGAGCTGGTCTACTCCCTCCAGGAGGTCTTCAAGGCAGCCAGCGTTC 120

                          ||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| silico     121 CCGTGGACTTCGAGTGCTACTTCCTTTCCGAAATCAATCCCGTGCTTAGTGCCAAACTGG 180

                          |||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGGATGTGGTGGCATCCATTCAGAAAAACAAAGTGTGCATTAAGGGCGTTTTGGCCACAC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCGACTACAGCAATGTGGGTGACCTGCAGACCCTTAACATGAAGCTTCGCAACGACCTGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACCTCTACGCCAATGTGGTGCATGTGCGCAGCTTGCCCGGTGTCAAGACCCGCCACACCA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACATCGACACGGTGATTATTCGCGAGCAGACGGAGGGCGAGTATTCGGCGTTGGAGCACG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGTCGGTGCCCGGCATTGTGGAGTGCCTGAAGATTATCACCGCCAAAAAGTCCATGCGCA 480

6439R-1.IR_full       481 TTGCCAAGTTCGCCTTCGAC 500
                          |||||||||||||||||||| silico     481 TTGCCAAGTTCGCCTTCGAC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142743.1  CG6439-RA (CG6439), mRNA 
0   NM_137256.1  CG15701-RA (CG15701), mRNA 
0   NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 
0   NM_078587.2  CG4353-RC, transcript variant C (hep), mRNA 
0   NR_002483.1  CG4353-RC, transcript variant C (hep), mRNA, miscRNA 
0   NM_169874.1  CG4608-RA (bnl), mRNA 
0   NM_078582.3  CG32659-RA (Ten-a), mRNA 
0   NM_138031.1  CG3173-RA (CG3173), mRNA 
0   NM_168115.1  CG10645-RA, transcript variant A (lama), mRNA 
0   NM_079209.2  CG10645-RB, transcript variant B (lama), mRNA 
0   NM_168116.1  CG10645-RC, transcript variant C (lama), mRNA 
0   NM_169487.1  CG31342-RA (CG31342), mRNA 
0   NM_132263.2  CG12111-RA (CG12111), mRNA 
0   NM_168534.2  CG11271-RB, transcript variant B (RpS12), mRNA 
0   NM_079328.2  CG11271-RC, transcript variant C (RpS12), mRNA 
0   NM_136237.2  CG9265-RA (CG9265), mRNA 
0   NM_143359.1  CG14065-RA (CG14065), mRNA 
0   NM_079170.2  CG1066-RB, transcript variant B (Shab), mRNA 
0   NM_001043115.1  CG1066-RC, transcript variant C (Shab), mRNA 
0   NM_167967.1  CG1066-RA, transcript variant A (Shab), mRNA 
0   NM_134317.3  CG12021-RA, transcript variant A (Patj), mRNA 
0   NM_057994.4  CG12021-RC, transcript variant C (Patj), mRNA 
0   NM_167917.2  CG12021-RB, transcript variant B (Patj), mRNA 
0   NM_165168.1  CG31738-RA, transcript variant A (CG31738), mRNA 
0   NM_135957.2  CG31738-RB, transcript variant B (CG31738), mRNA 
0   NM_140068.2  CG3428-RA (CG3428), mRNA 
0   NM_164993.1  CG6618-RA, transcript variant A (Patsas), mRNA 
0   NM_165621.1  CG30357-RA (CG30357), mRNA 
0   NM_165839.2  CG17835-RD, transcript variant D (inv), mRNA 
0   NM_165838.2  CG17835-RC, transcript variant C (inv), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.