National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6435R-2 
 Symbol CG6435  Full Name CG6435 
 CG No CG6435  Old CG No CG6435 
 Synonyms CG6435 
 Accession No (Link to NCBI) NM_137321.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCTGCAATGCATCCGCAAT 
 Primer Seq. 3'
aatctagaggtaccAAACCGTTTCCTGCTCCTTGA 
 Predicted Fragment Size
371 
 IR fragment full Seq
0001 TGGCTGCAAT GCATCCGCAA TTTGCGTAAA TGGGGCCTGC GGTATATTCC GAATCACTTG 
0061 GGGCTACTGG GNTGGAGGCG GGCAAACTAA CTTTGCCCAC AGATACAGCT CTCTCCGAAG 
0121 ACGCTTTTAC GAACTGCGTT AATCAGCCCC ACTGTGCAGC GAACACGGTG CAGNAATTAT 
0181 ATGTTCAAAC ATGGCCAGGA TTGCAATGGA GACGAGCACA TCGATTGCCT GGATTTCGGA 
0241 GCACTCCACA AACTGGGCAA TCTGAAGTGC CAGGAAGAGT TGCCCTACAT CTTTGCCAAA 
0301 GTCTTCAATC GATGTCTGAA ATCCAAGGAG CGGATGGCAG AGGAAAAGAT CATCAAGGAG 
0361 CAGGAAACGG TTT 
 in silico PCR Fragment
0001 TGGCTGCAAT GCATCCGCAA TTTGCGTAAA TGGGGCCTGC GGTATATTCC GAATCACTTG 
0061 GGGCTACTGG G-TGGAGGCG GGCAAACTAA CTTTGCCCAC AGATACAGCT CTCTCCGAAG 
0121 ACGCTTTTAC GAACTGCGTT AATCAGCCCC ACTGTGCAGC GAACACGGTG CAG-AATTAT 
0181 ATGTTCAAAC ATGGCCAGGA TTGCAATGGA GACGAGCACA TCGATTGCCT GGATTTCGGA 
0241 GCACTCCACA AACTGGGCAA TCTGAAGTGC CAGGAAGAGT TGCCCTACAT CTTTGCCAAA 
0301 GTCTTCAATC GATGTCTGAA ATCCAAGGAG CGGATGGCAG AGGAAAAGAT CATCAAGGAG 
0361 CAGGAAACGG TTT 
 Assemble Data

6435R-2.IR_full       1   TGGCTGCAATGCATCCGCAATTTGCGTAAATGGGGCCTGCGGTATATTCCGAATCACTTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6435R-2.in silico     1   TGGCTGCAATGCATCCGCAATTTGCGTAAATGGGGCCTGCGGTATATTCCGAATCACTTG 60


6435R-2.IR_full       61  GGGCTACTGGGNTGGAGGCGGGCAAACTAACTTTGCCCACAGATACAGCTCTCTCCGAAG 120
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
6435R-2.in silico     61  GGGCTACTGGG-TGGAGGCGGGCAAACTAACTTTGCCCACAGATACAGCTCTCTCCGAAG 120


6435R-2.IR_full       121 ACGCTTTTACGAACTGCGTTAATCAGCCCCACTGTGCAGCGAACACGGTGCAGNAATTAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
6435R-2.in silico     121 ACGCTTTTACGAACTGCGTTAATCAGCCCCACTGTGCAGCGAACACGGTGCAG-AATTAT 180


6435R-2.IR_full       181 ATGTTCAAACATGGCCAGGATTGCAATGGAGACGAGCACATCGATTGCCTGGATTTCGGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6435R-2.in silico     181 ATGTTCAAACATGGCCAGGATTGCAATGGAGACGAGCACATCGATTGCCTGGATTTCGGA 240


6435R-2.IR_full       241 GCACTCCACAAACTGGGCAATCTGAAGTGCCAGGAAGAGTTGCCCTACATCTTTGCCAAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6435R-2.in silico     241 GCACTCCACAAACTGGGCAATCTGAAGTGCCAGGAAGAGTTGCCCTACATCTTTGCCAAA 300


6435R-2.IR_full       301 GTCTTCAATCGATGTCTGAAATCCAAGGAGCGGATGGCAGAGGAAAAGATCATCAAGGAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6435R-2.in silico     301 GTCTTCAATCGATGTCTGAAATCCAAGGAGCGGATGGCAGAGGAAAAGATCATCAAGGAG 360


6435R-2.IR_full       361 CAGGAAACGGTTT 373
                          |||||||||||||
6435R-2.in silico     361 CAGGAAACGGTTT 373

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   353  NM_137321.2  CG6435-RA (CG6435), mRNA 
0   NM_139817.2  CG14823-RD, transcript variant D (CG14823), mRNA 
0   NM_168186.1  CG14823-RA, transcript variant A (CG14823), mRNA 
0   NM_137319.2  CG6426-RA (CG6426), mRNA 
0   NM_136949.1  CG13151-RA (CG13151), mRNA 
0   NM_057796.2  CG10379-RA (mbc), mRNA 
0   NM_135892.2  CG4185-RA (NC2beta), mRNA 
0   NM_164463.1  CG7082-RD, transcript variant D (CG7082), mRNA 
0   NM_164462.1  CG7082-RB, transcript variant B (CG7082), mRNA 
0   NM_134813.2  CG7082-RC, transcript variant C (CG7082), mRNA 
0   NM_164461.1  CG7082-RA, transcript variant A (CG7082), mRNA 
0   NM_169789.1  CG7913-RB, transcript variant B (PP2A-B'), mRNA 
0   NM_079821.2  CG1954-RA (Pkc98E), mRNA 
0   NM_132180.1  CG10920-RA (CG10920), mRNA 
0   NM_057579.3  CG12759-RA (Dbp45A), mRNA 
0   NM_169790.1  CG7913-RA, transcript variant A (PP2A-B'), mRNA 
0   NM_142112.2  CG8279-RA (Pde6), mRNA 
0   NM_139743.2  CG10483-RA (CG10483), mRNA 
0   NM_176582.1  CG14509-RA (CG14509), mRNA 
0   16  25  NM_143791.2  CG6421-RA (CG6421), mRNA 
0   NM_165909.2  CG8824-RC, transcript variant C (fdl), mRNA 
0   NM_165912.1  CG8819-RC, transcript variant C (achi), mRNA 
0   NM_165908.1  CG8824-RB, transcript variant B (fdl), mRNA 
0   NM_165911.1  CG8819-RA, transcript variant A (achi), mRNA 
0   NM_176157.1  CG8821-RB, transcript variant B (vis), mRNA 
0   NM_078990.2  CG8821-RA, transcript variant A (vis), mRNA 
0   NM_130497.2  CG13363-RA (Suv4-20), mRNA 
0   NM_164908.2  CG5640-RC, transcript variant C (CG5640), mRNA 
0   NM_135524.3  CG5640-RA, transcript variant A (CG5640), mRNA 
0   NM_164907.2  CG5640-RB, transcript variant B (CG5640), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.