National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6435R-1 
 Symbol CG6435  Full Name CG6435 
 CG No CG6435  Old CG No CG6435 
 Synonyms CG6435 
 Accession No (Link to NCBI) NM_137321.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGCTGCAATGCATCCGCAATTTGCGTAAATGGGGCCTGCGGTATATTCCGAATCACTTG 60

                          ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGGCTACTGGG-TGGAGGCGGGCAAACTAACTTTGCCCACAGATACAGCTCTCTCCGAAG 120

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| silico     121 ACGCTTTTACGAACTGCGTTAATCAGCCCCACTGTGCAGCGAACACGGTGCAG-AATTAT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATGTTCAAACATGGCCAGGATTGCAATGGAGACGAGCACATCGATTGCCTGGATTTCGGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCACTCCACAAACTGGGCAATCTGAAGTGCCAGGAAGAGTTGCCCTACATCTTTGCCAAA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GTCTTCAATCGATGTCTGAAATCCAAGGAGCGGATGGCAGAGGAAAAGATCATCAAGGAG 360

6435R-1.IR_full       361 CAGGAAACGGTTT 373
                          ||||||||||||| silico     361 CAGGAAACGGTTT 373

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   353  NM_137321.2  CG6435-RA (CG6435), mRNA 
0   NM_139817.2  CG14823-RD, transcript variant D (CG14823), mRNA 
0   NM_168186.1  CG14823-RA, transcript variant A (CG14823), mRNA 
0   NM_137319.2  CG6426-RA (CG6426), mRNA 
0   NM_136949.1  CG13151-RA (CG13151), mRNA 
0   NM_057796.2  CG10379-RA (mbc), mRNA 
0   NM_135892.2  CG4185-RA (NC2beta), mRNA 
0   NM_164463.1  CG7082-RD, transcript variant D (CG7082), mRNA 
0   NM_164462.1  CG7082-RB, transcript variant B (CG7082), mRNA 
0   NM_134813.2  CG7082-RC, transcript variant C (CG7082), mRNA 
0   NM_164461.1  CG7082-RA, transcript variant A (CG7082), mRNA 
0   NM_169789.1  CG7913-RB, transcript variant B (PP2A-B'), mRNA 
0   NM_079821.2  CG1954-RA (Pkc98E), mRNA 
0   NM_132180.1  CG10920-RA (CG10920), mRNA 
0   NM_057579.3  CG12759-RA (Dbp45A), mRNA 
0   NM_169790.1  CG7913-RA, transcript variant A (PP2A-B'), mRNA 
0   NM_142112.2  CG8279-RA (Pde6), mRNA 
0   NM_139743.2  CG10483-RA (CG10483), mRNA 
0   NM_176582.1  CG14509-RA (CG14509), mRNA 
0   16  25  NM_143791.2  CG6421-RA (CG6421), mRNA 
0   NM_165909.2  CG8824-RC, transcript variant C (fdl), mRNA 
0   NM_165912.1  CG8819-RC, transcript variant C (achi), mRNA 
0   NM_165908.1  CG8824-RB, transcript variant B (fdl), mRNA 
0   NM_165911.1  CG8819-RA, transcript variant A (achi), mRNA 
0   NM_176157.1  CG8821-RB, transcript variant B (vis), mRNA 
0   NM_078990.2  CG8821-RA, transcript variant A (vis), mRNA 
0   NM_130497.2  CG13363-RA (Suv4-20), mRNA 
0   NM_164908.2  CG5640-RC, transcript variant C (CG5640), mRNA 
0   NM_135524.3  CG5640-RA, transcript variant A (CG5640), mRNA 
0   NM_164907.2  CG5640-RB, transcript variant B (CG5640), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.