National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6429R-1 
 Symbol CG6429  Full Name CG6429 
 CG No CG6429  Old CG No CG6429 
 Synonyms BcDNA:RH62928, CG6429 
 Accession No (Link to NCBI) NM_137320.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGTGTGAGGCTTTGAGTGGCT 
 Primer Seq. 3'
aatctagaggtaccTTCTGACGCTTGTCATTCCGC 
 Predicted Fragment Size
364 
 IR fragment full Seq
0001 TGTGTGAGGC TTTGAGTGGC TGCAACGCGA CGGCTGTGTG CGTGAATGGG GCATGTGGCA 
0061 TTTTCAGGAT CACTTGGGAT CAGTGGGTGG ACTCAGGCAG ATTGACCATA CCTGGCGACT 
0121 CGCCANTGAC GGATAGTTCT TTTACCAACT GCGCCAATGA TCCGTATTGT GCGGCCGATA 
0181 CTTTGCAGAG TTATATGGTG AAGTACGGAC AGGATTGCAA CGATGATCAG AAGGAGGACT 
0241 GTTACGATTA TGGTGCCATT CACTATATGG GTCCCTTCAA CTGCAAGGCG GATATGCCCT 
0301 ACACCTACGA GAGCATTTTC AAACGATGTT TGAGGAACGC GATGCGGAAT GACAAGCGTC 
0361 AGAA 
 in silico PCR Fragment
0001 TGTGTGAGGC TTTGAGTGGC TGCAACGCGA CGGCTGTGTG CGTGAATGGG GCATGTGGCA 
0061 TTTTCAGGAT CACTTGGGAT CAGTGGGTGG ACTCAGGCAG ATTGACCATA CCTGGCGACT 
0121 CGCCATTGAC GGATAGTTCT TTTACCAACT GCGCCAATGA TCCGTATTGT GCGGCCGATA 
0181 CTTTGCAGAG TTATATGGTG AAGTACGGAC AGGATTGCAA CGATGATCAG AAGGAGGACT 
0241 GTTACGATTA TGGTGCCATT CACTATATGG GTCCCTTCAA CTGCAAGGCG GATATGCCCT 
0301 ACACCTACGA GAGCATTTTC AAACGATGTT TGAGGAACGC GATGCGGAAT GACAAGCGTC 
0361 AGAA 
 Assemble Data

6429R-1.IR_full       1   TGTGTGAGGCTTTGAGTGGCTGCAACGCGACGGCTGTGTGCGTGAATGGGGCATGTGGCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6429R-1.in silico     1   TGTGTGAGGCTTTGAGTGGCTGCAACGCGACGGCTGTGTGCGTGAATGGGGCATGTGGCA 60


6429R-1.IR_full       61  TTTTCAGGATCACTTGGGATCAGTGGGTGGACTCAGGCAGATTGACCATACCTGGCGACT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6429R-1.in silico     61  TTTTCAGGATCACTTGGGATCAGTGGGTGGACTCAGGCAGATTGACCATACCTGGCGACT 120


6429R-1.IR_full       121 CGCCANTGACGGATAGTTCTTTTACCAACTGCGCCAATGATCCGTATTGTGCGGCCGATA 180
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
6429R-1.in silico     121 CGCCATTGACGGATAGTTCTTTTACCAACTGCGCCAATGATCCGTATTGTGCGGCCGATA 180


6429R-1.IR_full       181 CTTTGCAGAGTTATATGGTGAAGTACGGACAGGATTGCAACGATGATCAGAAGGAGGACT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6429R-1.in silico     181 CTTTGCAGAGTTATATGGTGAAGTACGGACAGGATTGCAACGATGATCAGAAGGAGGACT 240


6429R-1.IR_full       241 GTTACGATTATGGTGCCATTCACTATATGGGTCCCTTCAACTGCAAGGCGGATATGCCCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6429R-1.in silico     241 GTTACGATTATGGTGCCATTCACTATATGGGTCCCTTCAACTGCAAGGCGGATATGCCCT 300


6429R-1.IR_full       301 ACACCTACGAGAGCATTTTCAAACGATGTTTGAGGAACGCGATGCGGAATGACAAGCGTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6429R-1.in silico     301 ACACCTACGAGAGCATTTTCAAACGATGTTTGAGGAACGCGATGCGGAATGACAAGCGTC 360


6429R-1.IR_full       361 AGAA 364
                          ||||
6429R-1.in silico     361 AGAA 364

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   346  NM_137320.2  CG6429-RA (CG6429), mRNA 
0   NM_166373.2  CG11025-RB, transcript variant B (isopeptidase-T-3), mRNA 
0   NM_137595.1  CG11025-RA, transcript variant A (isopeptidase-T-3), mRNA 
0   NM_132023.1  CG15773-RA (CG15773), mRNA 
0   NM_132026.1  CG4078-RA (CG4078), mRNA 
0   NM_139749.2  CG10479-RA (CG10479), mRNA 
0   NM_080377.2  CG10207-RA (NaPi-T), mRNA 
0   NM_176229.1  CG33147-RA (CG33147), mRNA 
0   25  NM_143791.2  CG6421-RA (CG6421), mRNA 
0   NM_143085.1  CG11848-RA (CG11848), mRNA 
0   NM_058156.2  CG9280-RA, transcript variant A (Glt), mRNA 
0   NM_164831.1  CG9280-RB, transcript variant B (Glt), mRNA 
0   NM_164832.1  CG9280-RC, transcript variant C (Glt), mRNA 
0   NM_134938.2  CG3238-RA (CG3238), mRNA 
0   NM_166342.1  CG11961-RA, transcript variant A (CG11961), mRNA 
0   NM_137569.3  CG11961-RB, transcript variant B (CG11961), mRNA 
0   NM_057977.3  CG9239-RA, transcript variant A (B4), mRNA 
0   NM_165046.1  CG9239-RB, transcript variant B (B4), mRNA 
0   NM_137277.2  CG7989-RA (l(2)k07824), mRNA 
0   NM_080156.2  CG4535-RA (FKBP59), mRNA 
0   NM_206434.1  CG1347-RB, transcript variant B (CG1347), mRNA 
0   NM_141316.1  CG1347-RA, transcript variant A (CG1347), mRNA 
0   NM_164370.1  CG31974-RA (CG31974), mRNA 
0   NM_166921.1  CG4199-RE, transcript variant E (CG4199), mRNA 
0   NM_166924.1  CG4199-RF, transcript variant F (CG4199), mRNA 
0   NM_166923.1  CG4199-RC, transcript variant C (CG4199), mRNA 
0   NM_130620.2  CG4199-RD, transcript variant D (CG4199), mRNA 
0   NM_166922.1  CG4199-RB, transcript variant B (CG4199), mRNA 
0   NM_136555.1  CG8734-RA (CG8734), mRNA 
0   NM_206171.2  CG8201-RH, transcript variant H (par-1), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
DB
DC
++ 
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.