National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6392R-2 
 Symbol cmet  Full Name CENP-meta 
 CG No CG6392  Old CG No CG6392 
 Synonyms CENP-meta, DmCmeta, CENP-E meta, CG6392, KIF10, Cmet, l(2)04431, cmet, Cenp-E 
 Accession No (Link to NCBI) NM_080254.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Clemente-Ruiz M, Muzzopappa M, Milán M.
Tumor suppressor roles of CENP-E and Nsl1 in Drosophila epithelial tissues.
Cell Cycle (2014) 13(9) 1450-5 [ PubMed ID = 24626182 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCTGCATCAAGGTGCGTCCC 
 Primer Seq. 3'
aatctagaggtaccCATAGCAGGCGCAGGAGGTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTCTGCATCA AGGTGCGTCC CTGCGAGCCC GGGCTCACTA TCACTCTGGC AGGTGAAGGA 
0061 GGGCCGCTCC ATCCACTTGG CGGACAGcCA TGTCGGAGCC CTATGTCTTC GACTATGTGT 
0121 NTCGACGAGG GCGCCAGCAA CCAGGAGGTG TTCGACCGGA TGGCCAAGCA CATANGTGCA 
0181 CGCCTGCATG CAGGGCTTCA ACGGAACTAT TTTTGCCTAC GGCCAGACGT CGTCGGGCAA 
0241 GACGTACACC ATGATGGGCG ACGAACAGAA TCCGGGCGTC ATGGTGCTNA GCCGCCAAGG 
0301 AGATCTTTCA ACAGATCTCC AGTGAGACGG AGCGGGACTT TNTGCTGCGC GTGGGCTACA 
0361 TCGAGATCTA CAACGAGNAA GATCTACGAT CTGCTGAACA AGAAGAATCA GGACCTCAAG 
0421 ATCCATGAGT CCGGAAATGG GATTGTGAAT GTGAACTGCG AGGAGTGCAT CATAACCAGC 
0481 GAGGTTGACC TCCTgNGCCT GCTATG 
 in silico PCR Fragment
0001 GTCTGCATCA AGGTGCGTCC CTGCGAGCCC GGGCTCACT- TCACTCTGGC AGGTGAAGGA 
0061 GCGCCGCTCC ATCCACTTGG CGGACAGCCA TG-CGGAGCC CTATGTCTTC GACTATGTGT 
0121 -TCGACGAGG GCGCCAGCAA CCAGGAGGTG TTCGACCGGA TGGCCAAGCA CATA-GTGCA 
0181 CGCCTGCATG CAGGGCTTCA ACGGAACTAT TTTTGCCTAC GGCCAGACGT CGTCGGGCAA 
0241 GACGTACACC ATGATGGGCG ACGAACAGAA TCCGGGCGTC ATGGTGCT-A GCCGCCAAGG 
0301 AGATCTTTCA ACAGATCTCC AGTGAGACGG AGCGGGACTT TCTGCTGCGC GTGGGCTACA 
0361 TCGAGATCTA CAACGAG-AA GATCTACGAT CTGCTGAACA AGAAGAATCA GGACCTCAAG 
0421 ATCCATGAGT CCGGAAATGG GATTGTGAAT GTGAACTGCG AGGAGTGCAT CATAACCAGC 
0481 GAGGTTGACC TCCTGCGCCT GCTATG 
 Assemble Data

6392R-2.IR_full       1   GTCTGCATCAAGGTGCGTCCCTGCGAGCCCGGGCTCACTATCACTCTGGCAGGTGAAGGA 60
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
6392R-2.in silico     1   GTCTGCATCAAGGTGCGTCCCTGCGAGCCCGGGCTCACT-TCACTCTGGCAGGTGAAGGA 60


6392R-2.IR_full       61  GGGCCGCTCCATCCACTTGGCGGACAGCCATGTCGGAGCCCTATGTCTTCGACTATGTGT 120
                          | |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
6392R-2.in silico     61  GCGCCGCTCCATCCACTTGGCGGACAGCCATG-CGGAGCCCTATGTCTTCGACTATGTGT 120


6392R-2.IR_full        121 TCGACGAGGGCGCCAGCAACCAGGAGGTGTTCGACCGGATGGCCAAGCACATANGTGCA 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
6392R-2.in silico      121 TCGACGAGGGCGCCAGCAACCAGGAGGTGTTCGACCGGATGGCCAAGCACATA-GTGCA 179


6392R-2.IR_full       181 CGCCTGCATGCAGGGCTTCAACGGAACTATTTTTGCCTACGGCCAGACGTCGTCGGGCAA 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6392R-2.in silico     181 CGCCTGCATGCAGGGCTTCAACGGAACTATTTTTGCCTACGGCCAGACGTCGTCGGGCAA 239


6392R-2.IR_full       241 GACGTACACCATGATGGGCGACGAACAGAATCCGGGCGTCATGGTGCTNAGCCGCCAAGG 299
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
6392R-2.in silico     241 GACGTACACCATGATGGGCGACGAACAGAATCCGGGCGTCATGGTGCT-AGCCGCCAAGG 299


6392R-2.IR_full       301 AGATCTTTCAACAGATCTCCAGTGAGACGGAGCGGGACTTTNTGCTGCGCGTGGGCTACA 359
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
6392R-2.in silico     301 AGATCTTTCAACAGATCTCCAGTGAGACGGAGCGGGACTTTCTGCTGCGCGTGGGCTACA 359


6392R-2.IR_full       361 TCGAGATCTACAACGAGNAAGATCTACGATCTGCTGAACAAGAAGAATCAGGACCTCAAG 419
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
6392R-2.in silico     361 TCGAGATCTACAACGAG-AAGATCTACGATCTGCTGAACAAGAAGAATCAGGACCTCAAG 419


6392R-2.IR_full       421 ATCCATGAGTCCGGAAATGGGATTGTGAATGTGAACTGCGAGGAGTGCATCATAACCAGC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6392R-2.in silico     421 ATCCATGAGTCCGGAAATGGGATTGTGAATGTGAACTGCGAGGAGTGCATCATAACCAGC 479


6392R-2.IR_full       481 GAGGTTGACCTCCTGNGCCTGCTATG 505
                          ||||||||||||||| ||||||||||
6392R-2.in silico     481 GAGGTTGACCTCCTGCGCCTGCTATG 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080254.2  CG6392-RA (cmet), mRNA 
75.51   364  73  26  23  NM_001032080.1  CG33695-RA, transcript variant A (CG33695), mRNA 
75.51   364  73  26  23  NM_001032076.1  CG33694-RA, transcript variant A (cana), mRNA 
0.41   22  27  NM_057469.3  CG10718-RA (neb), mRNA 
0   NM_001032231.1  CG18003-RA, transcript variant A (CG18003), mRNA 
0   NM_001032232.1  CG11919-RA, transcript variant A (CG11919), mRNA 
0   NM_135150.2  CG9162-RA (CG9162), mRNA 
0   NM_176177.1  CG33139-RA (Ranbp11), mRNA 
0   NM_001014741.1  CG11111-RC, transcript variant C (rdgB), mRNA 
0   NM_167382.1  CG11111-RA, transcript variant A (rdgB), mRNA 
0   NM_001014740.1  CG11111-RD, transcript variant D (rdgB), mRNA 
0   NM_078594.2  CG11111-RB, transcript variant B (rdgB), mRNA 
0   NM_080071.2  CG12028-RA (dib), mRNA 
0   NM_139708.1  CG4835-RA (CG4835), mRNA 
0   NM_134685.2  CG4427-RB, transcript variant B (cbt), mRNA 
0   10  NM_079808.2  CG5658-RA (Klp98A), mRNA 
0   28  NM_057303.4  CG7831-RA (ncd), mRNA 
0   NM_079960.2  CG18105-RA (ETH), mRNA 
0   NM_141708.2  CG12807-RA (CG12807), mRNA 
0   NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_132260.2  CG12113-RA (l(1)G0095), mRNA 
0   NM_141497.1  CG2781-RA (CG2781), mRNA 
0   NM_140742.2  CG7497-RA (CG7497), mRNA 
0   NM_135857.1  CG16879-RA (CG16879), mRNA 
0   NM_080258.2  CG10229-RA (katanin-60), mRNA 
0   NM_165627.1  CG8740-RC, transcript variant C (CG8740), mRNA 
0   NM_057814.3  CG12244-RA (lic), mRNA 
0   NM_136567.2  CG8740-RA, transcript variant A (CG8740), mRNA 
0   NM_165931.1  CG8625-RC, transcript variant C (Iswi), mRNA 
0   NM_165930.1  CG8625-RB, transcript variant B (Iswi), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.