National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6380R-2 
 Symbol CG6380  Full Name CG6380 
 CG No CG6380  Old CG No CG6380 
 Synonyms CG6380 
 Accession No (Link to NCBI) NM_135989.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGGGACCAAGTAAAGGGCA 
 Primer Seq. 3'
aatctagaggtaccTTCGCCGTCGAGTTGATTGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGGGACCA AGTAAAGGGC ATCCTGAAGT CGGGAAACAA TAGTGCGCAA TTTAGCCTGA 
0061 AGGCAGCCAA ATTTGATGAG GTCAACATAC TGGCCACGTT CCACCCGGCT GGTAAGGACT 
0121 ACGGCCACAT GATCATCGAC GAACCAAAGA CACCCTTCGT CTTTGAGGAG GATTTGCCAA 
0181 AGGAGTTGGA TACAAATGCC CTGATCGAAA AGTTGAGACA CACATCAAAG TCAGAAATGC 
0241 CGGCATTTGG CATCGAAGGA GACTCAGAAG AATCCTCGGC GGATGAGGAC TTTCCCGAGT 
0301 CTGTAGAGGA AAAAGTGCGT AGAATGGAGT TTGAGAGGCG GCGAAAAGTG CATTACAAGG 
0361 AGTTCTATTC GGTTCCACTG GCTCGACGTC TTATAGCCGA CGAGTTTGCC GAGTTGACCA 
0421 GTTCAGAGTT TAATATTCAC TGCGAAGGGG GAATGGAATC TTGTGAAGCG TGCAGTGAAA 
0481 ACAATCAACT CGACGGCGAA  
 in silico PCR Fragment
0001 ATGGGGACCA AGTAAAGGGC ATCCTGAAGT CGGGAAACAA TAGTGCGCAA TTTAGCCTGA 
0061 AGGCAGCCAA ATTTGATGAG GTCAACATAC TGGCCACGTT CCACCCGGCT GGTAAGGACT 
0121 ACGGCCACAT GATCATCGAC GAACCAAAGA CACCCTTCGT CTTTGAGGAG GATTTGCCAA 
0181 AGGAGTTGGA TACAAATGCC CTGATCGAAA AGTTGAGACA CACATCAAAG TCAGAAATGC 
0241 CGGCATTTGG CATCGAAGGA GACTCAGAAG AATCCTCGGC GGATGAGGAC TTTCCCGAGT 
0301 CTGTAGAGGA AAAAGTGCGT AGAATGGAGT TTGAGAGGCG GCGAAAAGTG CATTACAAGG 
0361 AGTTCTATTC GGTTCCACTG GCTCGACGTC TTATAGCCGA CGAGTTTGCC GAGTTGACCA 
0421 GTTCAGAGTT TAATATTCAC TGCGAAGGGG GAATGGAATC TTGTGAAGCG TGCAGTGAAA 
0481 ACAATCAACT CGACGGCGAA  
 Assemble Data

6380R-2.IR_full       1   ATGGGGACCAAGTAAAGGGCATCCTGAAGTCGGGAAACAATAGTGCGCAATTTAGCCTGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6380R-2.in silico     1   ATGGGGACCAAGTAAAGGGCATCCTGAAGTCGGGAAACAATAGTGCGCAATTTAGCCTGA 60


6380R-2.IR_full       61  AGGCAGCCAAATTTGATGAGGTCAACATACTGGCCACGTTCCACCCGGCTGGTAAGGACT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6380R-2.in silico     61  AGGCAGCCAAATTTGATGAGGTCAACATACTGGCCACGTTCCACCCGGCTGGTAAGGACT 120


6380R-2.IR_full       121 ACGGCCACATGATCATCGACGAACCAAAGACACCCTTCGTCTTTGAGGAGGATTTGCCAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6380R-2.in silico     121 ACGGCCACATGATCATCGACGAACCAAAGACACCCTTCGTCTTTGAGGAGGATTTGCCAA 180


6380R-2.IR_full       181 AGGAGTTGGATACAAATGCCCTGATCGAAAAGTTGAGACACACATCAAAGTCAGAAATGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6380R-2.in silico     181 AGGAGTTGGATACAAATGCCCTGATCGAAAAGTTGAGACACACATCAAAGTCAGAAATGC 240


6380R-2.IR_full       241 CGGCATTTGGCATCGAAGGAGACTCAGAAGAATCCTCGGCGGATGAGGACTTTCCCGAGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6380R-2.in silico     241 CGGCATTTGGCATCGAAGGAGACTCAGAAGAATCCTCGGCGGATGAGGACTTTCCCGAGT 300


6380R-2.IR_full       301 CTGTAGAGGAAAAAGTGCGTAGAATGGAGTTTGAGAGGCGGCGAAAAGTGCATTACAAGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6380R-2.in silico     301 CTGTAGAGGAAAAAGTGCGTAGAATGGAGTTTGAGAGGCGGCGAAAAGTGCATTACAAGG 360


6380R-2.IR_full       361 AGTTCTATTCGGTTCCACTGGCTCGACGTCTTATAGCCGACGAGTTTGCCGAGTTGACCA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6380R-2.in silico     361 AGTTCTATTCGGTTCCACTGGCTCGACGTCTTATAGCCGACGAGTTTGCCGAGTTGACCA 420


6380R-2.IR_full       421 GTTCAGAGTTTAATATTCACTGCGAAGGGGGAATGGAATCTTGTGAAGCGTGCAGTGAAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6380R-2.in silico     421 GTTCAGAGTTTAATATTCACTGCGAAGGGGGAATGGAATCTTGTGAAGCGTGCAGTGAAA 480


6380R-2.IR_full       481 ACAATCAACTCGACGGCGAA 500
                          ||||||||||||||||||||
6380R-2.in silico     481 ACAATCAACTCGACGGCGAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135989.1  CG6380-RA (CG6380), mRNA 
0   NM_139882.1  CG7716-RA (CG7716), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_078745.2  CG12676-RA (ed), mRNA 
0   NM_143639.1  CG2118-RA, transcript variant A (CG2118), mRNA 
0   NM_170577.1  CG2118-RB, transcript variant B (CG2118), mRNA 
0   NM_138233.1  CG9094-RB, transcript variant B (CG9094), mRNA 
0   10  NM_079289.2  CG10574-RA (I-2), mRNA 
0   NM_206627.1  CG4068-RB, transcript variant B (CG4068), mRNA 
0   NM_131971.2  CG4068-RA, transcript variant A (CG4068), mRNA 
0   NM_137551.2  CG15117-RA, transcript variant A (CG15117), mRNA 
0   NM_166324.1  CG15117-RB, transcript variant B (CG15117), mRNA 
0   NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
0   NM_168279.2  CG32352-RA, transcript variant A (CG32352), mRNA 
0   NM_168278.1  CG32352-RB, transcript variant B (CG32352), mRNA 
0   NM_001014535.1  CG15117-RC, transcript variant C (CG15117), mRNA 
0   NM_136844.3  CG9005-RA (CG9005), mRNA 
0   NM_001042793.1  CG2845-RB, transcript variant B (phl), mRNA 
0   NM_080308.2  CG2845-RA, transcript variant A (phl), mRNA 
0   NM_139861.2  CG8562-RA (CG8562), mRNA 
0   NM_141300.1  CG2919-RA (CG2919), mRNA 
0   NM_169649.1  CG5044-RB, transcript variant B (CG5044), mRNA 
0   NM_142196.2  CG5044-RA, transcript variant A (CG5044), mRNA 
0   NM_140275.1  CG14125-RA (CG14125), mRNA 
0   NM_079383.2  CG4531-RA (argos), mRNA 
0   NM_165152.1  CG5848-RA, transcript variant A (cact), mRNA 
0   NM_057594.3  CG5848-RB, transcript variant B (cact), mRNA 
0   NM_205999.1  CG5848-RD, transcript variant D (cact), mRNA 
0   NM_058133.3  CG31426-RA (ligatin), mRNA 
0   NM_169506.1  CG8795-RB, transcript variant B (CG8795), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.