National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6357R-3 
 Symbol CG6357  Full Name CG6357 
 CG No CG6357  Old CG No CG6357 
 Synonyms CG6357 
 Accession No (Link to NCBI) NM_137063.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TTTACTTGGCGTCCCACTGCTCCTGTATTTGATGGGCGTGGCTCTGGGCGTACCAGTAAG 60

                          ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| silico     61  CACATCATCACCTGCTACACAAAAAATCAATCCAGAGATTGGGGTTACTACTGGGAAAAG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGACGCTGACTCATCGACACCCACAATTGAACACACCTCTGGCTTATCTGAGTTCGAGGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGAATGCCAGTTTGCATGGCAAAGGTTCTTGGTCGACTTTGATGTACACTACGATAATGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTACGAACGGCAAAAGCGACGTGATATATTCTGCGAAAATTGGCAAAAAGTTCGCGATCA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAATTTGAAATACGATTTGGGAGTTGTCAGCTTCAAGAAGGGTATCAACCAGTGGAGTGA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCTTACCTTTGAAGAGTGGAAAGAGAAACAAACTCCCAAAGTTATGCCAGAAATCGCTAG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGAATCATCAAAGGAGGAGCGAGACAAAGTCAATTGCCAGGCTGCATGGGAAAAGTTTTT 480

6357R-3.IR_full       481 GATTGACTTTGGAGCGCAGT 500
                          |||||||||||||||||||| silico     481 GATTGACTTTGGAGCGCAGT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  25  68  NM_137063.2  CG6357-RA (CG6357), mRNA 
0.2   NM_132927.2  CG18358-RA (CG18358), mRNA 
0   NM_140196.2  CG7600-RA (CG7600), mRNA 
0   NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_001014584.1  CG4879-RC, transcript variant C (RecQ5), mRNA 
0   NM_079346.2  CG4879-RA, transcript variant A (RecQ5), mRNA 
0   NM_132760.3  CG9009-RA (CG9009), mRNA 
0   NM_078500.3  CG4317-RA (Mipp2), mRNA 
0   NM_167688.1  CG32529-RC, transcript variant C (CG32529), mRNA 
0   NM_001038766.1  CG32529-RD, transcript variant D (CG32529), mRNA 
0   NM_140307.2  CG10335-RA (Pbgs), mRNA 
0   NM_167485.1  CG9216-RC, transcript variant C (CG9216), mRNA 
0   NM_132878.1  CG9216-RA, transcript variant A (CG9216), mRNA 
0   NM_141522.1  CG11672-RA (CG11672), mRNA 
0   NM_137650.2  CG9945-RA, transcript variant A (CG9945), mRNA 
0   NM_137990.2  CG4797-RA, transcript variant A (CG4797), mRNA 
0   NM_166403.1  CG9945-RB, transcript variant B (CG9945), mRNA 
0   NM_078803.1  CG4105-RA (Cyp4e3), mRNA 
0   NM_166625.1  CG4797-RB, transcript variant B (CG4797), mRNA 
0   NM_078722.2  CG17941-RA (ds), mRNA 
0   NM_001043265.1  CG34139-RA (CG34139), mRNA 
0   NM_079962.3  CG18042-RA (lmg), mRNA 
0   NM_134943.1  CG3213-RA (CG3213), mRNA 
0   NM_001042841.1  CG40500-RD, transcript variant D (CG40500), mRNA 
0   NM_165552.2  CG18812-RC, transcript variant C (CG18812), mRNA 
0   NM_176337.1  CG33158-RB (CG33158), mRNA 
0   NM_079701.4  CG3671-RA, transcript variant A (Mvl), mRNA 
0   NM_168566.1  CG32135-RA (CG32135), mRNA 
0   NM_169944.1  CG3671-RB, transcript variant B (Mvl), mRNA 
0   NM_057438.3  CG6172-RA, transcript variant A (vnd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.