National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6357R-1 
 Symbol CG6357  Full Name CG6357 
 CG No CG6357  Old CG No CG6357 
 Synonyms CG6357 
 Accession No (Link to NCBI) NM_137063.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTACTTGGCGTCCCACTGCT 
 Primer Seq. 3'
aatctagaggtaccACTGCGCTCCAAAGTCAATCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTTACTTGGC GTCCCACTGC TCCTGTATTT GATGGGCGTG GCTCTGGGCG TACCAGTAAG 
0061 CACATCATCA CCTGCTACAC AAAAAATCAG TCCAGAGATT GGGGTTACTA CTGGGAAAAG 
0121 CGACGCTGAC TCATCGACAC CCACAATTGA ACACACCTCT GGCTTATCTG AGTTCGAGGA 
0181 GGAATGCCAG TTTGCATGGC AAAGGTTCTT GGTCGACTTT GATGTACACT ACGATAATGA 
0241 CTACGAACGG CAAAAGCGAC GTGATATATT CTGCGAAAAT TGGCAAAAAG TTCGCGATCA 
0301 CAATTTGAAA TACGATTTGG GAGTTGTCAG CTTCAAGAAG GGTATCAACC AGTGGAGTGA 
0361 TCTTACCTTT GAAGAGTGGA AAGAGAAACA AACTCCCAAA GTTATGCCAG AAATCGCTAG 
0421 TGAATCATCA AAGGAGGAGC GAGACAAAGT CAATTGCCAG GCTGCATGGG AAAAGTTTTT 
0481 GATTGACTTT GGAGCGCAGT  
 in silico PCR Fragment
0001 TTTACTTGGC GTCCCACTGC TCCTGTATTT GATGGGCGTG GCTCTGGGCG TACCAGTAAG 
0061 CACATCATCA CCTGCTACAC AAAAAATCAA TCCAGAGATT GGGGTTACTA CTGGGAAAAG 
0121 CGACGCTGAC TCATCGACAC CCACAATTGA ACACACCTCT GGCTTATCTG AGTTCGAGGA 
0181 GGAATGCCAG TTTGCATGGC AAAGGTTCTT GGTCGACTTT GATGTACACT ACGATAATGA 
0241 CTACGAACGG CAAAAGCGAC GTGATATATT CTGCGAAAAT TGGCAAAAAG TTCGCGATCA 
0301 CAATTTGAAA TACGATTTGG GAGTTGTCAG CTTCAAGAAG GGTATCAACC AGTGGAGTGA 
0361 TCTTACCTTT GAAGAGTGGA AAGAGAAACA AACTCCCAAA GTTATGCCAG AAATCGCTAG 
0421 TGAATCATCA AAGGAGGAGC GAGACAAAGT CAATTGCCAG GCTGCATGGG AAAAGTTTTT 
0481 GATTGACTTT GGAGCGCAGT  
 Assemble Data

6357R-1.IR_full       1   TTTACTTGGCGTCCCACTGCTCCTGTATTTGATGGGCGTGGCTCTGGGCGTACCAGTAAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6357R-1.in silico     1   TTTACTTGGCGTCCCACTGCTCCTGTATTTGATGGGCGTGGCTCTGGGCGTACCAGTAAG 60


6357R-1.IR_full       61  CACATCATCACCTGCTACACAAAAAATCAGTCCAGAGATTGGGGTTACTACTGGGAAAAG 120
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
6357R-1.in silico     61  CACATCATCACCTGCTACACAAAAAATCAATCCAGAGATTGGGGTTACTACTGGGAAAAG 120


6357R-1.IR_full       121 CGACGCTGACTCATCGACACCCACAATTGAACACACCTCTGGCTTATCTGAGTTCGAGGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6357R-1.in silico     121 CGACGCTGACTCATCGACACCCACAATTGAACACACCTCTGGCTTATCTGAGTTCGAGGA 180


6357R-1.IR_full       181 GGAATGCCAGTTTGCATGGCAAAGGTTCTTGGTCGACTTTGATGTACACTACGATAATGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6357R-1.in silico     181 GGAATGCCAGTTTGCATGGCAAAGGTTCTTGGTCGACTTTGATGTACACTACGATAATGA 240


6357R-1.IR_full       241 CTACGAACGGCAAAAGCGACGTGATATATTCTGCGAAAATTGGCAAAAAGTTCGCGATCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6357R-1.in silico     241 CTACGAACGGCAAAAGCGACGTGATATATTCTGCGAAAATTGGCAAAAAGTTCGCGATCA 300


6357R-1.IR_full       301 CAATTTGAAATACGATTTGGGAGTTGTCAGCTTCAAGAAGGGTATCAACCAGTGGAGTGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6357R-1.in silico     301 CAATTTGAAATACGATTTGGGAGTTGTCAGCTTCAAGAAGGGTATCAACCAGTGGAGTGA 360


6357R-1.IR_full       361 TCTTACCTTTGAAGAGTGGAAAGAGAAACAAACTCCCAAAGTTATGCCAGAAATCGCTAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6357R-1.in silico     361 TCTTACCTTTGAAGAGTGGAAAGAGAAACAAACTCCCAAAGTTATGCCAGAAATCGCTAG 420


6357R-1.IR_full       421 TGAATCATCAAAGGAGGAGCGAGACAAAGTCAATTGCCAGGCTGCATGGGAAAAGTTTTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6357R-1.in silico     421 TGAATCATCAAAGGAGGAGCGAGACAAAGTCAATTGCCAGGCTGCATGGGAAAAGTTTTT 480


6357R-1.IR_full       481 GATTGACTTTGGAGCGCAGT 500
                          ||||||||||||||||||||
6357R-1.in silico     481 GATTGACTTTGGAGCGCAGT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  25  68  NM_137063.2  CG6357-RA (CG6357), mRNA 
0.2   NM_132927.2  CG18358-RA (CG18358), mRNA 
0   NM_140196.2  CG7600-RA (CG7600), mRNA 
0   NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_001014584.1  CG4879-RC, transcript variant C (RecQ5), mRNA 
0   NM_079346.2  CG4879-RA, transcript variant A (RecQ5), mRNA 
0   NM_132760.3  CG9009-RA (CG9009), mRNA 
0   NM_078500.3  CG4317-RA (Mipp2), mRNA 
0   NM_167688.1  CG32529-RC, transcript variant C (CG32529), mRNA 
0   NM_001038766.1  CG32529-RD, transcript variant D (CG32529), mRNA 
0   NM_140307.2  CG10335-RA (Pbgs), mRNA 
0   NM_167485.1  CG9216-RC, transcript variant C (CG9216), mRNA 
0   NM_132878.1  CG9216-RA, transcript variant A (CG9216), mRNA 
0   NM_141522.1  CG11672-RA (CG11672), mRNA 
0   NM_137650.2  CG9945-RA, transcript variant A (CG9945), mRNA 
0   NM_137990.2  CG4797-RA, transcript variant A (CG4797), mRNA 
0   NM_166403.1  CG9945-RB, transcript variant B (CG9945), mRNA 
0   NM_078803.1  CG4105-RA (Cyp4e3), mRNA 
0   NM_166625.1  CG4797-RB, transcript variant B (CG4797), mRNA 
0   NM_078722.2  CG17941-RA (ds), mRNA 
0   NM_001043265.1  CG34139-RA (CG34139), mRNA 
0   NM_079962.3  CG18042-RA (lmg), mRNA 
0   NM_134943.1  CG3213-RA (CG3213), mRNA 
0   NM_001042841.1  CG40500-RD, transcript variant D (CG40500), mRNA 
0   NM_165552.2  CG18812-RC, transcript variant C (CG18812), mRNA 
0   NM_176337.1  CG33158-RB (CG33158), mRNA 
0   NM_079701.4  CG3671-RA, transcript variant A (Mvl), mRNA 
0   NM_168566.1  CG32135-RA (CG32135), mRNA 
0   NM_169944.1  CG3671-RB, transcript variant B (Mvl), mRNA 
0   NM_057438.3  CG6172-RA, transcript variant A (vnd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.