National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6347R-2 
 Symbol CG6347  Full Name CG6347 
 CG No CG6347  Old CG No CG6347 
 Synonyms CG6347 
 Accession No (Link to NCBI) NM_137062.2 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGCGGATGTGCTCAACGATGTGGCTGCAGATGACGCTGGGACTGGCCCTGCTGGGTGCT 60

                          |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| silico     61  GTGTCATTGCAGCAACTGCAGTCGTTTCCCAAGCTCTGCG-ATGTGCAAAACTTCGACGA 120

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     121 CTTCCTCCGGCAGACGGGCAAGGTGTACTCGGATGAGGAGCGAGTCTATCGCGAGAGCAT 180

                          |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTTCGCGGCCAAGATGTCGCTGATCACGCTGAGCAATAAGAACGCCGACAACGGCGTGTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGGATTCCGGCTGGGCGTCAATACGCTGGCCGACATGACCAGAAAGGAGATAGCCACCTT 300

                          ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     301 GCTGGGCTCCAAAATCTCCGAATTTGGCGAGAGATATACGAATGGCCATATCAACTTTGT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GACTGCCAGGAATCCGGCGAGTGCCAATCTTCCCGAGATGTTCGATTGGCGCGAGAAGGG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGGAGTGACGCCACCGGGATTCCAGGGTGTGGGATGCGGTGCCTGCTGGTCGTTCGCCAC 480

6347R-2.IR_full       481 CACAGGAGCGCTCGAAGGACA 501
                          ||||||||||||||||||||| silico     481 CACAGGAGCGCTCGAAGGACA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137062.2  CG6347-RA (CG6347), mRNA 
0   NM_140725.1  CG18265-RA (CG18265), mRNA 
0   NM_135207.2  CG11319-RA (CG11319), mRNA 
0   NM_001015108.1  CG41049-PA.3 (CG41049), mRNA 
0   NM_137928.2  CG12782-RA (CG12782), mRNA 
0   NM_165070.2  CG8827-RB, transcript variant B (Ance), mRNA 
0   NM_057698.4  CG8827-RA, transcript variant A (Ance), mRNA 
0   NM_132524.1  CG1895-RA (Cyp28c1), mRNA 
0   NM_001031885.1  CG33692-RB, transcript variant B (CG33692), mRNA 
0   NM_001031888.1  CG33691-RB, transcript variant B (CG33691), mRNA 
0   NM_142185.2  CG6363-RA (MRG15), mRNA 
0   NM_001031887.1  CG33691-RC, transcript variant C (CG33691), mRNA 
0   NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0   NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0   NM_001031884.1  CG33692-RC, transcript variant C (CG33692), mRNA 
0   NM_170554.1  CG11522-RA, transcript variant A (RpL6), mRNA 
0   NM_143619.2  CG11522-RB, transcript variant B (RpL6), mRNA 
0   NM_141444.1  CG10061-RA (l(3)s2214), mRNA 
0   NM_142930.2  CG10198-RA (Nup98), mRNA 
0   NM_078664.2  CG5870-RA (beta-Spec), mRNA 
0   NM_167844.1  CG32479-RA (CG32479), mRNA 
0   NM_168304.1  CG5021-RB, transcript variant B (CG5021), mRNA 
0   NM_140013.2  CG5021-RA, transcript variant A (CG5021), mRNA 
0   10  NM_168796.1  CG32208-RA (825-Oak), mRNA 
0   10  NM_168797.1  CG32213-RA (CG32213), mRNA 
0   NM_140857.2  CG12519-RA (CG12519), mRNA 
0   NM_166616.1  CG5411-RA, transcript variant A (Pde8), mRNA 
0   NM_137970.3  CG5411-RE, transcript variant E (Pde8), mRNA 
0   NM_166618.1  CG5411-RB, transcript variant B (Pde8), mRNA 
0   NM_166617.1  CG5411-RD, transcript variant D (Pde8), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.