National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6347R-1 
 Symbol CG6347  Full Name CG6347 
 CG No CG6347  Old CG No CG6347 
 Synonyms CG6347 
 Accession No (Link to NCBI) NM_137062.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCGGATGTGCTCAACGATG 
 Primer Seq. 3'
aatctagaggtaccTGTCCTTCGAGCGCTCCTGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCGGATGT GCTCAACGAT GTGGCTGCAG ATGACGCTGG GACTGGCCCT GCTGGGTGCT 
0061 GTGTCATTGC AGCAACTGCA GTCGTTTCCC AAGCTCTGCG AATGTGCAAA ACTTCGACGA 
0121 CTTCCTCCGG CAGACGGGCA AGGTGTACTC GGATGAGGAG CGAGTCTATC GCGAGAGGAT 
0181 CTTCGCTGCC AAGATGTCGC TGATCACGCT GAGCAATAAG AACGCCGACA ACGGCGTGTC 
0241 CGGATTCCGG CTGGGCGTCA ATACGCTGGC CGACATGACC AGAAAGGAGA TAGCCACCTT 
0301 GCTGGGCTCC AAAATCTCCG AATTTGGCGA GAGATATACA AATGGCCATA TCAACTTTGT 
0361 GACTGCCAGG AATCCGGCGA GTGCCAATCT TCCCGAGATG TTCGATTGGC GCGAGAAGGG 
0421 CGGAGTGACG CCACCGGGAT TCCAGGGTGT GGGATGCGGT GCCTGCTGGT CGTTCGCCAC 
0481 CACAGGAGCG CTCGAAGGAC A 
 in silico PCR Fragment
0001 ATGCGGATGT GCTCAACGAT GTGGCTGCAG ATGACGCTGG GACTGGCCCT GCTGGGTGCT 
0061 GTGTCATTGC AGCAACTGCA GTCGTTTCCC AAGCTCTGCG -ATGTGCAAA ACTTCGACGA 
0121 CTTCCTCCGG CAGACGGGCA AGGTGTACTC GGATGAGGAG CGAGTCTATC GCGAGAGCAT 
0181 CTTCGCGGCC AAGATGTCGC TGATCACGCT GAGCAATAAG AACGCCGACA ACGGCGTGTC 
0241 CGGATTCCGG CTGGGCGTCA ATACGCTGGC CGACATGACC AGAAAGGAGA TAGCCACCTT 
0301 GCTGGGCTCC AAAATCTCCG AATTTGGCGA GAGATATACG AATGGCCATA TCAACTTTGT 
0361 GACTGCCAGG AATCCGGCGA GTGCCAATCT TCCCGAGATG TTCGATTGGC GCGAGAAGGG 
0421 CGGAGTGACG CCACCGGGAT TCCAGGGTGT GGGATGCGGT GCCTGCTGGT CGTTCGCCAC 
0481 CACAGGAGCG CTCGAAGGAC A 
 Assemble Data

6347R-1.IR_full       1   ATGCGGATGTGCTCAACGATGTGGCTGCAGATGACGCTGGGACTGGCCCTGCTGGGTGCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6347R-1.in silico     1   ATGCGGATGTGCTCAACGATGTGGCTGCAGATGACGCTGGGACTGGCCCTGCTGGGTGCT 60


6347R-1.IR_full       61  GTGTCATTGCAGCAACTGCAGTCGTTTCCCAAGCTCTGCGAATGTGCAAAACTTCGACGA 120
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
6347R-1.in silico     61  GTGTCATTGCAGCAACTGCAGTCGTTTCCCAAGCTCTGCG-ATGTGCAAAACTTCGACGA 120


6347R-1.IR_full       121 CTTCCTCCGGCAGACGGGCAAGGTGTACTCGGATGAGGAGCGAGTCTATCGCGAGAGGAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
6347R-1.in silico     121 CTTCCTCCGGCAGACGGGCAAGGTGTACTCGGATGAGGAGCGAGTCTATCGCGAGAGCAT 180


6347R-1.IR_full       181 CTTCGCTGCCAAGATGTCGCTGATCACGCTGAGCAATAAGAACGCCGACAACGGCGTGTC 240
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
6347R-1.in silico     181 CTTCGCGGCCAAGATGTCGCTGATCACGCTGAGCAATAAGAACGCCGACAACGGCGTGTC 240


6347R-1.IR_full       241 CGGATTCCGGCTGGGCGTCAATACGCTGGCCGACATGACCAGAAAGGAGATAGCCACCTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6347R-1.in silico     241 CGGATTCCGGCTGGGCGTCAATACGCTGGCCGACATGACCAGAAAGGAGATAGCCACCTT 300


6347R-1.IR_full       301 GCTGGGCTCCAAAATCTCCGAATTTGGCGAGAGATATACAAATGGCCATATCAACTTTGT 360
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
6347R-1.in silico     301 GCTGGGCTCCAAAATCTCCGAATTTGGCGAGAGATATACGAATGGCCATATCAACTTTGT 360


6347R-1.IR_full       361 GACTGCCAGGAATCCGGCGAGTGCCAATCTTCCCGAGATGTTCGATTGGCGCGAGAAGGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6347R-1.in silico     361 GACTGCCAGGAATCCGGCGAGTGCCAATCTTCCCGAGATGTTCGATTGGCGCGAGAAGGG 420


6347R-1.IR_full       421 CGGAGTGACGCCACCGGGATTCCAGGGTGTGGGATGCGGTGCCTGCTGGTCGTTCGCCAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6347R-1.in silico     421 CGGAGTGACGCCACCGGGATTCCAGGGTGTGGGATGCGGTGCCTGCTGGTCGTTCGCCAC 480


6347R-1.IR_full       481 CACAGGAGCGCTCGAAGGACA 501
                          |||||||||||||||||||||
6347R-1.in silico     481 CACAGGAGCGCTCGAAGGACA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137062.2  CG6347-RA (CG6347), mRNA 
0   NM_140725.1  CG18265-RA (CG18265), mRNA 
0   NM_135207.2  CG11319-RA (CG11319), mRNA 
0   NM_001015108.1  CG41049-PA.3 (CG41049), mRNA 
0   NM_137928.2  CG12782-RA (CG12782), mRNA 
0   NM_165070.2  CG8827-RB, transcript variant B (Ance), mRNA 
0   NM_057698.4  CG8827-RA, transcript variant A (Ance), mRNA 
0   NM_132524.1  CG1895-RA (Cyp28c1), mRNA 
0   NM_001031885.1  CG33692-RB, transcript variant B (CG33692), mRNA 
0   NM_001031888.1  CG33691-RB, transcript variant B (CG33691), mRNA 
0   NM_142185.2  CG6363-RA (MRG15), mRNA 
0   NM_001031887.1  CG33691-RC, transcript variant C (CG33691), mRNA 
0   NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0   NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0   NM_001031884.1  CG33692-RC, transcript variant C (CG33692), mRNA 
0   NM_170554.1  CG11522-RA, transcript variant A (RpL6), mRNA 
0   NM_143619.2  CG11522-RB, transcript variant B (RpL6), mRNA 
0   NM_141444.1  CG10061-RA (l(3)s2214), mRNA 
0   NM_142930.2  CG10198-RA (Nup98), mRNA 
0   NM_078664.2  CG5870-RA (beta-Spec), mRNA 
0   NM_167844.1  CG32479-RA (CG32479), mRNA 
0   NM_168304.1  CG5021-RB, transcript variant B (CG5021), mRNA 
0   NM_140013.2  CG5021-RA, transcript variant A (CG5021), mRNA 
0   10  NM_168796.1  CG32208-RA (825-Oak), mRNA 
0   10  NM_168797.1  CG32213-RA (CG32213), mRNA 
0   NM_140857.2  CG12519-RA (CG12519), mRNA 
0   NM_166616.1  CG5411-RA, transcript variant A (Pde8), mRNA 
0   NM_137970.3  CG5411-RE, transcript variant E (Pde8), mRNA 
0   NM_166618.1  CG5411-RB, transcript variant B (Pde8), mRNA 
0   NM_166617.1  CG5411-RD, transcript variant D (Pde8), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.