National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6343R-2 
 Symbol ND42  Full Name NADH:ubiquinone reductase 42kD subunit precursor 
 CG No CG6343  Old CG No CG6343 
 Synonyms CG6343, ND42 
 Accession No (Link to NCBI) NM_079721.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hochmuth CE, Biteau B, Bohmann D, Jasper H.
Redox regulation by Keap1 and Nrf2 controls intestinal stem cell proliferation in Drosophila.
Cell Stem Cell (2011) 8(2) 188-99 [ PubMed ID = 21295275 ] [ RRC reference ]

Tan SWS, Yip GW, Suda T, Baeg GH.
Small Maf functions in the maintenance of germline stem cells in the Drosophila testis.
Redox Biol (2018) 15 125-134 [ PubMed ID = 29245136 ] [ RRC reference ]

Tan SWS, Lee QY, Wong BSE, Cai Y, Baeg GH.
Redox Homeostasis Plays Important Roles in the Maintenance of the Drosophila Testis Germline Stem Cells.
Stem Cell Reports (2017) 9(1) 342-354 [ PubMed ID = 28669604 ] [ RRC reference ]

Owusu-Ansah E, Banerjee U.
Reactive oxygen species prime Drosophila haematopoietic progenitors for differentiation.
Nature (2009) 461(7263) 537-41 [ PubMed ID = 19727075 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCAGCATCTCCGGCAAGAC 
 Primer Seq. 3'
aatctagaggtaccGCCGAAACATGGCCTCCATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCAGCATC TCCGGCAAGA CGATGCGAGG TGGACCACGG GTGCCCAAGG cCGCCCCCTA 
0061 TCCGTACAAG ACGAAGAAGT ACAGCGTGTT CAATGCTATT TTCGACAAGA CCTCCAAGCG 
0121 TTTTGACGAG AACTCCAAGG TGATCTGTGT GGAGGGACCC ATCGCGGCCG GCAAGTCAAA 
0181 GTNTCGCCAA GGAACTGGCT GAGGAGCTGG ACATGGAGTA CTATCCGGCA GTTGATCTGG 
0241 ACCTAATCTA CATCAATTCG TACGGCTATG ACATGAGGAA GTTGGATCCT CAGTTGCCGC 
0301 CCAGCTGCCG AAGCTACGAT GTGCGCAACT TCTGCCTGGA TCCCAGCCAC GATCTGGCTG 
0361 CCCAGTTCCA GATTCGCATG TACATgctgC GCNTATTCGC AGTACATTGA TgNCCTGCAG 
0421 CACGTCCTTA GCACCGGCCA GGGTGTTGTC CTCGAgNGCA GCCCCTACTC GGACTTTGTC 
0481 TTCATGGAGG CCATGTTTCG GC 
 in silico PCR Fragment
0001 ATGCAGCATC TCCGGCAAGA CGATGCGAGG TGGACCACGG GTGCCCAAGG CCGCCCCCTA 
0061 TCCGTACAAG ACGAAGAAGT ACAGCGTGTT CAATGCTATT TTCGACAAGA CCTCCAAGCG 
0121 TTTTGACGAG AACTCCAAGG TGATCTGTGT GGAGGGACCC ATCGCGGCCG GCAAGTCAAA 
0181 GT-TCGCCAA GGAACTGGCT GAGGAGCTGG ACATGGAGTA CTATCCGGCA GTTGATCTGG 
0241 ACCTAATCTA CATCAATTCG TACGGCTATG ACATGAGGAA GTTGGATCCT CAGTTGCCGC 
0301 CCAGCTGCCG AAGCTACGAT GTGCGCAACT TCTGCCTGGA TCCCAGCCAC GATCTGGCTG 
0361 CCCAGTTCCA GATTCGCATG TACATGCTGC GC-TATTCGC AGTACATTGA TGCCCTGCAG 
0421 CACGTCCTTA GCACCGGCCA GGGTGTTGTC CTCGAGCGCA GCCCCTACTC GGACTTTGTC 
0481 TTCATGGAGG CCATGTTTCG GC 
 Assemble Data

6343R-2.IR_full       1   ATGCAGCATCTCCGGCAAGACGATGCGAGGTGGACCACGGGTGCCCAAGGCCGCCCCCTA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6343R-2.in silico     1   ATGCAGCATCTCCGGCAAGACGATGCGAGGTGGACCACGGGTGCCCAAGGCCGCCCCCTA 60


6343R-2.IR_full       61  TCCGTACAAGACGAAGAAGTACAGCGTGTTCAATGCTATTTTCGACAAGACCTCCAAGCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6343R-2.in silico     61  TCCGTACAAGACGAAGAAGTACAGCGTGTTCAATGCTATTTTCGACAAGACCTCCAAGCG 120


6343R-2.IR_full       121 TTTTGACGAGAACTCCAAGGTGATCTGTGTGGAGGGACCCATCGCGGCCGGCAAGTCAAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6343R-2.in silico     121 TTTTGACGAGAACTCCAAGGTGATCTGTGTGGAGGGACCCATCGCGGCCGGCAAGTCAAA 180


6343R-2.IR_full       181 GTNTCGCCAAGGAACTGGCTGAGGAGCTGGACATGGAGTACTATCCGGCAGTTGATCTGG 240
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6343R-2.in silico     181 GT-TCGCCAAGGAACTGGCTGAGGAGCTGGACATGGAGTACTATCCGGCAGTTGATCTGG 240


6343R-2.IR_full       241 ACCTAATCTACATCAATTCGTACGGCTATGACATGAGGAAGTTGGATCCTCAGTTGCCGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6343R-2.in silico     241 ACCTAATCTACATCAATTCGTACGGCTATGACATGAGGAAGTTGGATCCTCAGTTGCCGC 300


6343R-2.IR_full       301 CCAGCTGCCGAAGCTACGATGTGCGCAACTTCTGCCTGGATCCCAGCCACGATCTGGCTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6343R-2.in silico     301 CCAGCTGCCGAAGCTACGATGTGCGCAACTTCTGCCTGGATCCCAGCCACGATCTGGCTG 360


6343R-2.IR_full       361 CCCAGTTCCAGATTCGCATGTACATGCTGCGCNTATTCGCAGTACATTGATGNCCTGCAG 420
                          |||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||
6343R-2.in silico     361 CCCAGTTCCAGATTCGCATGTACATGCTGCGC-TATTCGCAGTACATTGATGCCCTGCAG 420


6343R-2.IR_full       421 CACGTCCTTAGCACCGGCCAGGGTGTTGTCCTCGAGNGCAGCCCCTACTCGGACTTTGTC 480
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
6343R-2.in silico     421 CACGTCCTTAGCACCGGCCAGGGTGTTGTCCTCGAGCGCAGCCCCTACTCGGACTTTGTC 480


6343R-2.IR_full       481 TTCATGGAGGCCATGTTTCGGC 502
                          ||||||||||||||||||||||
6343R-2.in silico     481 TTCATGGAGGCCATGTTTCGGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079721.2  CG6343-RA, transcript variant A (ND42), mRNA 
100   482  NM_169990.1  CG6343-RB, transcript variant B (ND42), mRNA 
0.41   NM_136855.1  CG13193-RA (CG13193), mRNA 
0   NM_142054.1  CG14365-RA (CG14365), mRNA 
0   NM_142642.1  CG4159-RA (CG4159), mRNA 
0   NM_057771.2  CG1864-RB, transcript variant B (Hr38), mRNA 
0   NM_176065.1  CG1864-RC, transcript variant C (Hr38), mRNA 
0   NM_164725.1  CG9188-RE, transcript variant E (sip2), mRNA 
0   NM_164724.1  CG9188-RD, transcript variant D (sip2), mRNA 
0   NM_135246.2  CG9188-RA, transcript variant A (sip2), mRNA 
0   NM_164722.1  CG9188-RB, transcript variant B (sip2), mRNA 
0   NM_164723.1  CG9188-RC, transcript variant C (sip2), mRNA 
0   NM_142562.1  CG6231-RA, transcript variant A (CG6231), mRNA 
0   NM_169864.1  CG6231-RB, transcript variant B (CG6231), mRNA 
0   NM_169866.1  CG6231-RD, transcript variant D (CG6231), mRNA 
0   NM_169865.1  CG6231-RC, transcript variant C (CG6231), mRNA 
0   11  NM_001042796.1  CG6775-RC, transcript variant C (rg), mRNA 
0   11  NM_080023.1  CG6775-RA, transcript variant A (rg), mRNA 
0   11  NM_167028.1  CG6775-RB, transcript variant B (rg), mRNA 
0   NM_176746.1  CG5424-RC, transcript variant C (f), mRNA 
0   NM_176745.1  CG5424-RD, transcript variant D (f), mRNA 
0   NM_001042819.1  CG5424-RF, transcript variant F (f), mRNA 
0   NM_078660.2  CG5424-RB, transcript variant B (f), mRNA 
0   NM_057604.3  CG1825-RA (Map60), mRNA 
0   NM_142893.1  CG10177-RA (CG10177), mRNA 
0   NM_133073.2  CG6394-RA, transcript variant A (GalNAc-T2), mRNA 
0   NM_167623.1  CG6394-RB, transcript variant B (GalNAc-T2), mRNA 
0   NM_130672.2  CG2712-RA (CG2712), mRNA 
0   NM_140817.1  CG14076-RA (CG14076), mRNA 
0   NM_135101.1  CG18266-RA (CG18266), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
++ 
DB
++ 
DC
++ 
DM
VM
+- 
VB
+- 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
VM
VB
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.