National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6341R-3 
 Symbol Ef1beta  Full Name Elongation factor 1 beta 
 CG No CG6341  Old CG No CG6341 
 Synonyms 154264_at, CG6341, unnamed, Elf 1 beta, BcDNA.LD24492, Ef1beta, EG:EG0003.7, BcDNA:LD24492 
 Accession No (Link to NCBI) NM_080069.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACCGCCACATCGCCTCCTTT 
 Primer Seq. 3'
aatctagaggtaccGATCTTGTTGAAGGCAGCAAT 
 Predicted Fragment Size
501 
 IR fragment full Seq
0001 TACCGCCACA TCGCCTCCTT TGAGGCCGCT GAGCGTGCCG CTTGGTCGGG TACTCCTCTG 
0061 CCCCAGTTGG CCGGTGGAAA GCCCACAGTG GCTGCTGCTG CCAAGCCCGC CGCCGACGAT 
0121 GACGACGATG TGGATCTATT CGGATCCGAC GACGAGGAGG ACGAGGAGGC CGAGCGCATC 
0181 AAGCAGGAGC GATGTNTGCC GCTTACGCCG CCAAGAAGTC TAAGAAACCC GCCCTCATTG 
0241 CCAAGTCGTC GGTGCTCCTC GATGTCAAGC CCTGGGATGA CGAGACCGAC ATGAAGGAGA 
0301 TGGAGAACAA TGTCCGCACC ATCGAAATGG ACGGTCTGCT GTGGGGCGCC TCCAAACTGG 
0361 TCCCAGTCGG CTATGGCATC AACAAGTTGC AGATCATGTG CGTCATCGAG GACGACAAGG 
0421 TGTCCATCGA TTTGCTGCAG GAGAAGATCG AGGAGTTCGA GGACTTTGTT CAGTCTGTCG 
0481 ACATTGCTGC CTTCAACAAG ATC 
 in silico PCR Fragment
0001 TACCGCCACA TCGCCTCCTT TGAGGCCGCT GAGCGTGCCG CTTGGTCGGG TACTCCTCTG 
0061 CCCCAGTTGG CCGGTGGAAA GCCCACAGTG GCTGCTGCTG CCAAGCCCGC CGCCGACGAT 
0121 GACGACGATG TGGATCTATT CGGATCCGAC GACGAGGAGG ACGAGGAGGC CGAGCGCATC 
0181 AAGCAGGAGC GA-GT-TGCC GCTTACGCCG CCAAGAAGTC TAAGAAACCC GCCCTCATTG 
0241 CCAAGTCGTC GGTGCTCCTC GATGTCAAGC CCTGGGATGA CGAGACCGAC ATGAAGGAGA 
0301 TGGAGAACAA TGTCCGCACC ATCGAAATGG ACGGTCTGCT GTGGGGCGCC TCCAAACTGG 
0361 TCCCAGTCGG CTATGGCATC AACAAGTTGC AGATCATGTG CGTCATCGAG GACGACAAGG 
0421 TGTCCATCGA TTTGCTGCAG GAGAAGATCG AGGAGTTCGA GGACTTTGTT CAGTCTGTCG 
0481 ACATTGCTGC CTTCAACAAG ATC 
 Assemble Data

6341R-3.IR_full       1   TACCGCCACATCGCCTCCTTTGAGGCCGCTGAGCGTGCCGCTTGGTCGGGTACTCCTCTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6341R-3.in silico     1   TACCGCCACATCGCCTCCTTTGAGGCCGCTGAGCGTGCCGCTTGGTCGGGTACTCCTCTG 60


6341R-3.IR_full       61  CCCCAGTTGGCCGGTGGAAAGCCCACAGTGGCTGCTGCTGCCAAGCCCGCCGCCGACGAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6341R-3.in silico     61  CCCCAGTTGGCCGGTGGAAAGCCCACAGTGGCTGCTGCTGCCAAGCCCGCCGCCGACGAT 120


6341R-3.IR_full       121 GACGACGATGTGGATCTATTCGGATCCGACGACGAGGAGGACGAGGAGGCCGAGCGCATC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6341R-3.in silico     121 GACGACGATGTGGATCTATTCGGATCCGACGACGAGGAGGACGAGGAGGCCGAGCGCATC 180


6341R-3.IR_full       181 AAGCAGGAGCGATGTNTGCCGCTTACGCCGCCAAGAAGTCTAAGAAACCCGCCCTCATTG 240
                          |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
6341R-3.in silico     181 AAGCAGGAGCGA-GT-TGCCGCTTACGCCGCCAAGAAGTCTAAGAAACCCGCCCTCATTG 240


6341R-3.IR_full       241 CCAAGTCGTCGGTGCTCCTCGATGTCAAGCCCTGGGATGACGAGACCGACATGAAGGAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6341R-3.in silico     241 CCAAGTCGTCGGTGCTCCTCGATGTCAAGCCCTGGGATGACGAGACCGACATGAAGGAGA 300


6341R-3.IR_full       301 TGGAGAACAATGTCCGCACCATCGAAATGGACGGTCTGCTGTGGGGCGCCTCCAAACTGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6341R-3.in silico     301 TGGAGAACAATGTCCGCACCATCGAAATGGACGGTCTGCTGTGGGGCGCCTCCAAACTGG 360


6341R-3.IR_full       361 TCCCAGTCGGCTATGGCATCAACAAGTTGCAGATCATGTGCGTCATCGAGGACGACAAGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6341R-3.in silico     361 TCCCAGTCGGCTATGGCATCAACAAGTTGCAGATCATGTGCGTCATCGAGGACGACAAGG 420


6341R-3.IR_full       421 TGTCCATCGATTTGCTGCAGGAGAAGATCGAGGAGTTCGAGGACTTTGTTCAGTCTGTCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6341R-3.in silico     421 TGTCCATCGATTTGCTGCAGGAGAAGATCGAGGAGTTCGAGGACTTTGTTCAGTCTGTCG 480


6341R-3.IR_full       481 ACATTGCTGCCTTCAACAAGATC 503
                          |||||||||||||||||||||||
6341R-3.in silico     481 ACATTGCTGCCTTCAACAAGATC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   483  12  NM_080069.3  CG6341-RA (Ef1beta), mRNA 
0.62   15  NM_140233.1  CG7339-RA (CG7339), mRNA 
0.2   10  15  44  NM_057786.3  CG7434-RA (RpL22), mRNA 
0   22  46  NM_135517.2  CG4912-RB, transcript variant B (eEF1delta), mRNA 
0   22  46  NM_164895.1  CG4912-RA, transcript variant A (eEF1delta), mRNA 
0   13  NM_137247.1  CG8434-RA (lbk), mRNA 
0   20  25  NM_141129.1  CG11523-RA (CG11523), mRNA 
0   15  45  NM_167309.1  CG32663-RA (CG32663), mRNA 
0   15  14  NM_080371.2  CG2040-RC, transcript variant C (hig), mRNA 
0   15  14  NM_001014514.1  CG2040-RD, transcript variant D (hig), mRNA 
0   15  10  NM_165666.1  CG2040-RB, transcript variant B (hig), mRNA 
0   15  10  NM_165667.1  CG2040-RA, transcript variant A (hig), mRNA 
0   14  28  NM_143338.2  CG12259-RA (CG12259), mRNA 
0   NM_079749.4  CG5405-RA, transcript variant A (KrT95D), mRNA 
0   NM_170108.2  CG5405-RB, transcript variant B (KrT95D), mRNA 
0   NM_170110.2  CG5405-RC, transcript variant C (KrT95D), mRNA 
0   15  46  NM_132346.1  CG3003-RB (CG3003), mRNA 
0   10  32  NM_141240.1  CG14656-RA (CG14656), mRNA 
0   26  NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0   24  NM_132437.1  CG15207-RA (CG15207), mRNA 
0   11  NM_139503.1  CG2162-RA (CG2162), mRNA 
0   13  NM_140719.2  CG3885-RA (CG3885), mRNA 
0   NM_168723.1  CG6479-RB, transcript variant B (CG6479), mRNA 
0   NM_140711.2  CG6479-RA, transcript variant A (CG6479), mRNA 
0   19  NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   15  27  NM_131924.2  CG4857-RB (CG4857), mRNA 
0   13  22  NM_168638.2  CG6117-RB, transcript variant B (Pka-C3), mRNA 
0   13  22  NM_079373.2  CG6117-RA, transcript variant A (Pka-C3), mRNA 
0   10  16  NM_168741.2  CG32180-RB, transcript variant B (Eip74EF), mRNA 
0   10  16  NM_001014590.1  CG32180-RD, transcript variant D (Eip74EF), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.