National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6337R-3 
 Symbol CG6337  Full Name CG6337 
 CG No CG6337  Old CG No CG6337 
 Synonyms CG6337 
 Accession No (Link to NCBI) NM_137061.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACAATGCCCAGGCCGATAGGAATCGCACCACCTACCGCGAGGCAGTGAATCAGTTCTCGG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACATCCGGCTCATCCAGTTCGCAGCCCTGCTGCCCAAAGCCGTGAATACGGTGACCTCGG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGGCCAGTGATCCACCGGCCAGTCAAGCGGCATCTGCCAGCTTTGACATTATCACGGATT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCGGACTCACCGTGGCGGTGGAGGATCAGGGCGTGAACTGCAGCAGTAGTTGGGCCTATG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCACCGCCAAGGCCGTGGAGATCATGAATGCCGTGCAGACAGCCAATCCTCTGCCCTCGT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCTTGTCCGCCCAGCAGCTGCTGGACTGTGCGGGCATGGGCACCGGATGCAGCACCCAGA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGCCCCTGGCTGCCCTCAACTATCTCACCCAGCTGACAGATGCGTATCTCTATCCGGAGG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGGACTATCCGAATAACAATAGCCTGAAAACGCCGGGTATGTGCCAGCCCCCATCCTCTG 480

6337R-3.IR_full       481 TGTCAGTGGGCGTGAAGTTG 500
                          |||||||||||||||||||| silico     481 TGTCAGTGGGCGTGAAGTTG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137061.2  CG6337-RA (CG6337), mRNA 
0   NM_206564.1  CG5794-RE, transcript variant E (CG5794), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_001038916.1  CG17689-RB, transcript variant B (CG17689), mRNA 
0   NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
0   NM_135643.2  CG6192-RA (CG6192), mRNA 
0   NM_079331.2  CG11280-RA (trn), mRNA 
0   NM_143317.1  CG5611-RA (CG5611), mRNA 
0   NM_167013.1  CG3000-RB, transcript variant B (rap), mRNA 
0   NM_080113.2  CG3000-RA, transcript variant A (rap), mRNA 
0   NM_144346.2  CG6264-RA (Best1), mRNA 
0   NM_136211.3  CG9320-RA (CG9320), mRNA 
0   NM_132433.1  CG2157-RA (CG2157), mRNA 
0   NM_138128.1  CG15859-RA (CG15859), mRNA 
0   NM_140316.2  CG32104-RB (CG32104), mRNA 
0   NM_169033.2  CG12163-RA, transcript variant A (CG12163), mRNA 
0   NM_141264.2  CG12163-RB, transcript variant B (CG12163), mRNA 
0   NM_079871.2  CG1775-RA, transcript variant A (Med), mRNA 
0   NM_170559.1  CG1775-RB, transcript variant B (Med), mRNA 
0   NM_137216.2  CG8249-RA (CG8249), mRNA 
0   NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_135100.2  CG7251-RA (CG7251), mRNA 
0   NM_001014693.1  CG1464-RD, transcript variant D (ey), mRNA 
0   NM_166789.1  CG1464-RB, transcript variant B (ey), mRNA 
0   NM_166513.1  CG11061-RB, transcript variant B (GM130), mRNA 
0   NM_137798.2  CG11061-RA, transcript variant A (GM130), mRNA 
0   NM_079889.2  CG1464-RA, transcript variant A (ey), mRNA 
0   NM_001014694.1  CG1464-RC, transcript variant C (ey), mRNA 
 Pathways (updated: 2024/04/26)
 KEGG Pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.