National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6337R-2 
 Symbol CG6337  Full Name CG6337 
 CG No CG6337  Old CG No CG6337 
 Synonyms CG6337 
 Accession No (Link to NCBI) NM_137061.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.<br> RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.<br> Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACAATGCCCAGGCCGATAGGA 
 Primer Seq. 3'
aatctagaggtaccCAACTTCACGCCCACTGACAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACAATGCCCA GGCCGATAgG AATCGCACCA CCTACCGCGA GGCAGTGAAT CAGTTCTCGG 
0061 ACATCCGGCT CATCCAGTTC GCAGCCCTGC TGCCCAAAGC CGTGAATACG GTGACCTCGG 
0121 CGGCCAGTGA TCCACCGGCC AGTCAAGCGG CATCTGCCAG CTTTGACATT ATCACGGATT 
0181 TCGGACTCAC CGTGGCGGTG GAGGATCAGG GCGTGAACTG CAGCAGTAGT TGGGCCTATG 
0241 CCACCGCCAA GGCCGTGGAG ATCATGAATG CCGTGCAGAC AGCCAATCCT CTGCCCTCGT 
0301 CCTTGTCCGC CCAGCAGCTG CTGGACTGTG CGGGCATGGG CACCGGATGC AGCACCCAGA 
0361 CGCCCCTGGC TGCCCTCAAC TATCTCACCC AGCTGACAGA TGCGTATCTC TATCCGGAGG 
0421 TGGACTATCC GAATAACAAT AGCCTGAAAA CGCCGGGTAT GTGCCAGCCC CCATCCTCTG 
0481 TGTCAGTGGG CGTGAAGTTG  
 in silico PCR Fragment
0001 ACAATGCCCA GGCCGATAGG AATCGCACCA CCTACCGCGA GGCAGTGAAT CAGTTCTCGG 
0061 ACATCCGGCT CATCCAGTTC GCAGCCCTGC TGCCCAAAGC CGTGAATACG GTGACCTCGG 
0121 CGGCCAGTGA TCCACCGGCC AGTCAAGCGG CATCTGCCAG CTTTGACATT ATCACGGATT 
0181 TCGGACTCAC CGTGGCGGTG GAGGATCAGG GCGTGAACTG CAGCAGTAGT TGGGCCTATG 
0241 CCACCGCCAA GGCCGTGGAG ATCATGAATG CCGTGCAGAC AGCCAATCCT CTGCCCTCGT 
0301 CCTTGTCCGC CCAGCAGCTG CTGGACTGTG CGGGCATGGG CACCGGATGC AGCACCCAGA 
0361 CGCCCCTGGC TGCCCTCAAC TATCTCACCC AGCTGACAGA TGCGTATCTC TATCCGGAGG 
0421 TGGACTATCC GAATAACAAT AGCCTGAAAA CGCCGGGTAT GTGCCAGCCC CCATCCTCTG 
0481 TGTCAGTGGG CGTGAAGTTG  
 Assemble Data
<PRE>

6337R-2.IR_full       1   ACAATGCCCAGGCCGATAGGAATCGCACCACCTACCGCGAGGCAGTGAATCAGTTCTCGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6337R-2.in silico     1   ACAATGCCCAGGCCGATAGGAATCGCACCACCTACCGCGAGGCAGTGAATCAGTTCTCGG 60


6337R-2.IR_full       61  ACATCCGGCTCATCCAGTTCGCAGCCCTGCTGCCCAAAGCCGTGAATACGGTGACCTCGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6337R-2.in silico     61  ACATCCGGCTCATCCAGTTCGCAGCCCTGCTGCCCAAAGCCGTGAATACGGTGACCTCGG 120


6337R-2.IR_full       121 CGGCCAGTGATCCACCGGCCAGTCAAGCGGCATCTGCCAGCTTTGACATTATCACGGATT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6337R-2.in silico     121 CGGCCAGTGATCCACCGGCCAGTCAAGCGGCATCTGCCAGCTTTGACATTATCACGGATT 180


6337R-2.IR_full       181 TCGGACTCACCGTGGCGGTGGAGGATCAGGGCGTGAACTGCAGCAGTAGTTGGGCCTATG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6337R-2.in silico     181 TCGGACTCACCGTGGCGGTGGAGGATCAGGGCGTGAACTGCAGCAGTAGTTGGGCCTATG 240


6337R-2.IR_full       241 CCACCGCCAAGGCCGTGGAGATCATGAATGCCGTGCAGACAGCCAATCCTCTGCCCTCGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6337R-2.in silico     241 CCACCGCCAAGGCCGTGGAGATCATGAATGCCGTGCAGACAGCCAATCCTCTGCCCTCGT 300


6337R-2.IR_full       301 CCTTGTCCGCCCAGCAGCTGCTGGACTGTGCGGGCATGGGCACCGGATGCAGCACCCAGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6337R-2.in silico     301 CCTTGTCCGCCCAGCAGCTGCTGGACTGTGCGGGCATGGGCACCGGATGCAGCACCCAGA 360


6337R-2.IR_full       361 CGCCCCTGGCTGCCCTCAACTATCTCACCCAGCTGACAGATGCGTATCTCTATCCGGAGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6337R-2.in silico     361 CGCCCCTGGCTGCCCTCAACTATCTCACCCAGCTGACAGATGCGTATCTCTATCCGGAGG 420


6337R-2.IR_full       421 TGGACTATCCGAATAACAATAGCCTGAAAACGCCGGGTATGTGCCAGCCCCCATCCTCTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6337R-2.in silico     421 TGGACTATCCGAATAACAATAGCCTGAAAACGCCGGGTATGTGCCAGCCCCCATCCTCTG 480


6337R-2.IR_full       481 TGTCAGTGGGCGTGAAGTTG 500
                          ||||||||||||||||||||
6337R-2.in silico     481 TGTCAGTGGGCGTGAAGTTG 500

</PRE>
 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137061.2  CG6337-RA (CG6337), mRNA 
0   NM_206564.1  CG5794-RE, transcript variant E (CG5794), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_001038916.1  CG17689-RB, transcript variant B (CG17689), mRNA 
0   NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
0   NM_135643.2  CG6192-RA (CG6192), mRNA 
0   NM_079331.2  CG11280-RA (trn), mRNA 
0   NM_143317.1  CG5611-RA (CG5611), mRNA 
0   NM_167013.1  CG3000-RB, transcript variant B (rap), mRNA 
0   NM_080113.2  CG3000-RA, transcript variant A (rap), mRNA 
0   NM_144346.2  CG6264-RA (Best1), mRNA 
0   NM_136211.3  CG9320-RA (CG9320), mRNA 
0   NM_132433.1  CG2157-RA (CG2157), mRNA 
0   NM_138128.1  CG15859-RA (CG15859), mRNA 
0   NM_140316.2  CG32104-RB (CG32104), mRNA 
0   NM_169033.2  CG12163-RA, transcript variant A (CG12163), mRNA 
0   NM_141264.2  CG12163-RB, transcript variant B (CG12163), mRNA 
0   NM_079871.2  CG1775-RA, transcript variant A (Med), mRNA 
0   NM_170559.1  CG1775-RB, transcript variant B (Med), mRNA 
0   NM_137216.2  CG8249-RA (CG8249), mRNA 
0   NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_135100.2  CG7251-RA (CG7251), mRNA 
0   NM_001014693.1  CG1464-RD, transcript variant D (ey), mRNA 
0   NM_166789.1  CG1464-RB, transcript variant B (ey), mRNA 
0   NM_166513.1  CG11061-RB, transcript variant B (GM130), mRNA 
0   NM_137798.2  CG11061-RA, transcript variant A (GM130), mRNA 
0   NM_079889.2  CG1464-RA, transcript variant A (ey), mRNA 
0   NM_001014694.1  CG1464-RC, transcript variant C (ey), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
     
 Pathways (updated: 2024/04/26)
 KEGG Pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.