National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6332R-3 
 Symbol CG6332  Full Name CG6332 
 CG No CG6332  Old CG No CG6332 
 Synonyms anon-WO0140519.231, CG6332 
 Accession No (Link to NCBI) NM_142742.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGATTGCTTCACAGGCGGCG 
 Primer Seq. 3'
aatctagaggtaccTGGTAAGTGGCTCGGACATCT 
 Predicted Fragment Size
494 
 IR fragment full Seq
0001 TCGATTGCTT CACAGGCGGC GAACGGCCAT TCTGGCGGGC GACTCAATTG GGGAGTCCAT 
0061 ACTGAACAGA TGGCTTCgCT ACAGCTATCT ATCGCTGTAC AGTCGTCTCA CGAATATCCA 
0121 GCCGTTGGTT AAGCCGAAGA AAAAGAAGAA GAAGACGGAG AAGCAGCTGG CTAAGCACGA 
0181 GAAGTACATC GAAAAGTTGG CGAAACCAAA GAAAGCACCA AAGGTCCCGA AACCGGATCG 
0241 TGGAGCTGGG GAGTTCGATC CCGTGCGTCT CAATCAGCTG GCCAGTCCCA AGGCCTATTT 
0301 GGAGGAGATC AAACCTAAGT GGGAGCTGAC CTCCCAGATG AAGGACTACA AGGCGACCAA 
0361 GCGGATCAAG CAAATATCGC AGCCCGTCGT GCGCGATAAT GTCCACATCA ACGAGAATCC 
0421 GGGAGAAGGT CTCGCCCAAT GCCCTTCGCT ACAAGCCGAG TGCCCGCATC AAGGAGATGT 
0481 CCGAGCCACT TACCA 
 in silico PCR Fragment
0001 TCGATTGCTT CACAGGCGGC GAACGGCCAT TCTGGCGGGC GACTCAATTG GGGAGTCCAT 
0061 ACTGAACAGA TGGCTTCGCT ACAGCTATCT ATCGCTGTAC AGTCGTCTCA CGAATATCCA 
0121 GCCGTTGGTT AAGCCGAAGA AAAAGAAGAA GAAGACGGAG AAGCAGCTGG CTAAGCACGA 
0181 GAAGTACATC GAAAAGTTGG CGAAACCAAA GAAAGCACCA AAGGTCCCGA AACCGGATCG 
0241 TGGAGCTGGG GAGTTCGATC CCGTGCGTCT CAATCAGCTG GCCAGTCCCA AGGCCTATTT 
0301 GGAGGAGATC AAACCCAAGT GGGAGCTGAC CTCCCAGATG AAGGACTACA AGGCGACCAA 
0361 GCGGATCAAG CAAATATCGC AGCCCGTCGT GCGCGATAAT GTCCACATCA ACGAGAATCC 
0421 -GGAGAAGGT CTCGCCCAAT GCCCTTCGCT ACAAGCCGAG TGCCCGCATC AAGGAGATGT 
0481 CCGAGCCACT TACCA 
 Assemble Data

6332R-3.IR_full       1   TCGATTGCTTCACAGGCGGCGAACGGCCATTCTGGCGGGCGACTCAATTGGGGAGTCCAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6332R-3.in silico     1   TCGATTGCTTCACAGGCGGCGAACGGCCATTCTGGCGGGCGACTCAATTGGGGAGTCCAT 60


6332R-3.IR_full       61  ACTGAACAGATGGCTTCGCTACAGCTATCTATCGCTGTACAGTCGTCTCACGAATATCCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6332R-3.in silico     61  ACTGAACAGATGGCTTCGCTACAGCTATCTATCGCTGTACAGTCGTCTCACGAATATCCA 120


6332R-3.IR_full       121 GCCGTTGGTTAAGCCGAAGAAAAAGAAGAAGAAGACGGAGAAGCAGCTGGCTAAGCACGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6332R-3.in silico     121 GCCGTTGGTTAAGCCGAAGAAAAAGAAGAAGAAGACGGAGAAGCAGCTGGCTAAGCACGA 180


6332R-3.IR_full       181 GAAGTACATCGAAAAGTTGGCGAAACCAAAGAAAGCACCAAAGGTCCCGAAACCGGATCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6332R-3.in silico     181 GAAGTACATCGAAAAGTTGGCGAAACCAAAGAAAGCACCAAAGGTCCCGAAACCGGATCG 240


6332R-3.IR_full       241 TGGAGCTGGGGAGTTCGATCCCGTGCGTCTCAATCAGCTGGCCAGTCCCAAGGCCTATTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6332R-3.in silico     241 TGGAGCTGGGGAGTTCGATCCCGTGCGTCTCAATCAGCTGGCCAGTCCCAAGGCCTATTT 300


6332R-3.IR_full       301 GGAGGAGATCAAACCTAAGTGGGAGCTGACCTCCCAGATGAAGGACTACAAGGCGACCAA 360
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
6332R-3.in silico     301 GGAGGAGATCAAACCCAAGTGGGAGCTGACCTCCCAGATGAAGGACTACAAGGCGACCAA 360


6332R-3.IR_full       361 GCGGATCAAGCAAATATCGCAGCCCGTCGTGCGCGATAATGTCCACATCAACGAGAATCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6332R-3.in silico     361 GCGGATCAAGCAAATATCGCAGCCCGTCGTGCGCGATAATGTCCACATCAACGAGAATCC 420


6332R-3.IR_full       421 GGGAGAAGGTCTCGCCCAATGCCCTTCGCTACAAGCCGAGTGCCCGCATCAAGGAGATGT 480
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6332R-3.in silico     421 -GGAGAAGGTCTCGCCCAATGCCCTTCGCTACAAGCCGAGTGCCCGCATCAAGGAGATGT 480


6332R-3.IR_full       481 CCGAGCCACTTACCA 495
                          |||||||||||||||
6332R-3.in silico     481 CCGAGCCACTTACCA 495

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   476  12  NM_142742.2  CG6332-RA (CG6332), mRNA 
0.63   NM_175978.1  CG14026-RD, transcript variant D (tkv), mRNA 
0.42   17  47  NM_001014547.1  CG3333-RB, transcript variant B (Nop60B), mRNA 
0.42   17  47  NM_080381.2  CG3333-RA, transcript variant A (Nop60B), mRNA 
0.21   19  51  NM_079319.2  CG4153-RA (eIF-2beta), mRNA 
0.21   10  38  NM_058064.3  CG10206-RA (nop5), mRNA 
0   NM_140729.1  CG13733-RA (CG13733), mRNA 
0   NM_135699.2  CG5317-RA (CG5317), mRNA 
0   11  18  NM_136033.2  CG12750-RA (ncm), mRNA 
0   10  25  NM_137196.1  CG12964-RA (CG12964), mRNA 
0   28  NM_169090.1  CG2182-RB, transcript variant B (CG2182), mRNA 
0   28  NM_141313.1  CG2182-RA, transcript variant A (CG2182), mRNA 
0   22  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   22  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_057420.3  CG7875-RA (trp), mRNA 
0   NM_142787.1  CG12499-RA (CG12499), mRNA 
0   35  121  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   16  59  NM_131944.1  CG3546-RA (CG3546), mRNA 
0   10  23  NM_139541.1  CG12017-RA (CG12017), mRNA 
0   31  NM_168387.1  CG6711-RA (Taf2), mRNA 
0   NM_135304.2  CG7154-RA (CG7154), mRNA 
0   29  NM_143015.2  CG13625-RA (CG13625), mRNA 
0   NM_143555.2  CG9717-RA (CG9717), mRNA 
0   NM_135017.2  CG15628-RA (CG15628), mRNA 
0   NM_136623.1  CG8014-RA (Rme-8), mRNA 
0   NM_078927.2  CG1555-RA (cn), mRNA 
0   NM_176045.1  CG4220-RB, transcript variant B (elB), mRNA 
0   NM_078842.4  CG4220-RA, transcript variant A (elB), mRNA 
0   10  NM_143030.2  CG18410-RA (CG18410), mRNA 
0   15  NM_134894.2  CG3542-RA, transcript variant A (CG3542), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.