National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6332R-1 
 Symbol CG6332  Full Name CG6332 
 CG No CG6332  Old CG No CG6332 
 Synonyms anon-WO0140519.231, CG6332 
 Accession No (Link to NCBI) NM_142742.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCGATTGCTTCACAGGCGGCGAACGGCCATTCTGGCGGGCGACTCAATTGGGGAGTCCAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACTGAACAGATGGCTTCGCTACAGCTATCTATCGCTGTACAGTCGTCTCACGAATATCCA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCCGTTGGTTAAGCCGAAGAAAAAGAAGAAGAAGACGGAGAAGCAGCTGGCTAAGCACGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAAGTACATCGAAAAGTTGGCGAAACCAAAGAAAGCACCAAAGGTCCCGAAACCGGATCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGGAGCTGGGGAGTTCGATCCCGTGCGTCTCAATCAGCTGGCCAGTCCCAAGGCCTATTT 300

                          ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| silico     301 GGAGGAGATCAAACCCAAGTGGGAGCTGACCTCCCAGATGAAGGACTACAAGGCGACCAA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCGGATCAAGCAAATATCGCAGCCCGTCGTGCGCGATAATGTCCACATCAACGAGAATCC 420

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 -GGAGAAGGTCTCGCCCAATGCCCTTCGCTACAAGCCGAGTGCCCGCATCAAGGAGATGT 480

6332R-1.IR_full       481 CCGAGCCACTTACCA 495
                          ||||||||||||||| silico     481 CCGAGCCACTTACCA 495

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   476  12  NM_142742.2  CG6332-RA (CG6332), mRNA 
0.63   NM_175978.1  CG14026-RD, transcript variant D (tkv), mRNA 
0.42   17  47  NM_001014547.1  CG3333-RB, transcript variant B (Nop60B), mRNA 
0.42   17  47  NM_080381.2  CG3333-RA, transcript variant A (Nop60B), mRNA 
0.21   19  51  NM_079319.2  CG4153-RA (eIF-2beta), mRNA 
0.21   10  38  NM_058064.3  CG10206-RA (nop5), mRNA 
0   NM_140729.1  CG13733-RA (CG13733), mRNA 
0   NM_135699.2  CG5317-RA (CG5317), mRNA 
0   11  18  NM_136033.2  CG12750-RA (ncm), mRNA 
0   10  25  NM_137196.1  CG12964-RA (CG12964), mRNA 
0   28  NM_169090.1  CG2182-RB, transcript variant B (CG2182), mRNA 
0   28  NM_141313.1  CG2182-RA, transcript variant A (CG2182), mRNA 
0   22  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   22  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_057420.3  CG7875-RA (trp), mRNA 
0   NM_142787.1  CG12499-RA (CG12499), mRNA 
0   35  121  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   16  59  NM_131944.1  CG3546-RA (CG3546), mRNA 
0   10  23  NM_139541.1  CG12017-RA (CG12017), mRNA 
0   31  NM_168387.1  CG6711-RA (Taf2), mRNA 
0   NM_135304.2  CG7154-RA (CG7154), mRNA 
0   29  NM_143015.2  CG13625-RA (CG13625), mRNA 
0   NM_143555.2  CG9717-RA (CG9717), mRNA 
0   NM_135017.2  CG15628-RA (CG15628), mRNA 
0   NM_136623.1  CG8014-RA (Rme-8), mRNA 
0   NM_078927.2  CG1555-RA (cn), mRNA 
0   NM_176045.1  CG4220-RB, transcript variant B (elB), mRNA 
0   NM_078842.4  CG4220-RA, transcript variant A (elB), mRNA 
0   10  NM_143030.2  CG18410-RA (CG18410), mRNA 
0   15  NM_134894.2  CG3542-RA, transcript variant A (CG3542), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.