National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6329R-3 
 Symbol CG6329  Full Name CG6329 
 CG No CG6329  Old CG No CG6329 
 Synonyms CG6329 
 Accession No (Link to NCBI) NM_166011.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees blistered wing 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTCGCCGTTCATGGAGAAG 
 Primer Seq. 3'
aatctagaggtaccACGAGCTCTGGAATCGTATTG 
 Predicted Fragment Size
466 
 IR fragment full Seq
0001 ATGTCGCCGT TCATGGAGAA GACGTTGTTG TTGTTAGGCG TGCTCTGCTG CATACAAGTG 
0061 ACCACTGCCC TGATGTGCTA CGACTGCAAC AGCGAGTTCG ATCCCCGCTG CGGCGATCCC 
0121 TTCGAGCCGT ACTCCATTGG CGAGGTGAAC TGCAGCAAAC AGGAGCCGCT GGAGCATCTG 
0181 AAGGACAAGT ACAAGCCCAC CCTGTGCCGC AAAACCGTGC AAAAGATTTA CGGGAAGACC 
0241 CGGATTGTGC GTGGATGCGG ATACATCCCA GACGAAAACA CCGACAACAA GTGCGTGAGA 
0301 CGCTCGGGAA CCCACGACGT GGCCGCCATC TACTGCTCCT GCACCAAGGA TCTGTGCAAC 
0361 GGGGCCAACT CGCCTGCTGG CCAGTGGATG ATGCTGCCCC TCATTGTGGC CGCCGGATTG 
0421 GCGCTCCTGC TGAACTCGAG GCACACAATA CGATTCCAGA GCTCGT 
 in silico PCR Fragment
0001 ATGTCGCCGT TCATGGAGAA GACGTTGTTG TTGTTAGGCG TGCTCTGCTG CATACAAGTG 
0061 ACCACTGCCC TGATGTGCTA CGACTGCAAC AGCGAGTTCG ATCCCCGCTG CGGCGATCCC 
0121 TTCGAGCCGT ACTCCATTGG CGAGGTGAAC TGCAGCAAAC AGGAGCCTCT GGAGCATCTG 
0181 AAGGACAAAT ACAAGCCCAC CCTGTGCCGC AAAACCGTGC AAAAGATTTA CGGGAAGACC 
0241 CGGATTGTGC GTGGATGCGG ATACATCCCA GACGAAAACA CCGACAACAA GTGCGTGAGA 
0301 CGCTCGGGAA CCCACGACGT GGCCGCCATC TACTGCTCCT GCACCAAGGA TCTGTGCAAC 
0361 GGGGCCAACT CGCCTGCTGG CCAGTGGATG ATGCTGCCCC TCATTGTGGC CGCCGGATTG 
0421 GCGCTCCTGC TGAACTCGAG GCACACAATA CGATTCCAGA GCTCGT 
 Assemble Data

6329R-3.IR_full       1   ATGTCGCCGTTCATGGAGAAGACGTTGTTGTTGTTAGGCGTGCTCTGCTGCATACAAGTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6329R-3.in silico     1   ATGTCGCCGTTCATGGAGAAGACGTTGTTGTTGTTAGGCGTGCTCTGCTGCATACAAGTG 60


6329R-3.IR_full       61  ACCACTGCCCTGATGTGCTACGACTGCAACAGCGAGTTCGATCCCCGCTGCGGCGATCCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6329R-3.in silico     61  ACCACTGCCCTGATGTGCTACGACTGCAACAGCGAGTTCGATCCCCGCTGCGGCGATCCC 120


6329R-3.IR_full       121 TTCGAGCCGTACTCCATTGGCGAGGTGAACTGCAGCAAACAGGAGCCGCTGGAGCATCTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
6329R-3.in silico     121 TTCGAGCCGTACTCCATTGGCGAGGTGAACTGCAGCAAACAGGAGCCTCTGGAGCATCTG 180


6329R-3.IR_full       181 AAGGACAAGTACAAGCCCACCCTGTGCCGCAAAACCGTGCAAAAGATTTACGGGAAGACC 240
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
6329R-3.in silico     181 AAGGACAAATACAAGCCCACCCTGTGCCGCAAAACCGTGCAAAAGATTTACGGGAAGACC 240


6329R-3.IR_full       241 CGGATTGTGCGTGGATGCGGATACATCCCAGACGAAAACACCGACAACAAGTGCGTGAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6329R-3.in silico     241 CGGATTGTGCGTGGATGCGGATACATCCCAGACGAAAACACCGACAACAAGTGCGTGAGA 300


6329R-3.IR_full       301 CGCTCGGGAACCCACGACGTGGCCGCCATCTACTGCTCCTGCACCAAGGATCTGTGCAAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6329R-3.in silico     301 CGCTCGGGAACCCACGACGTGGCCGCCATCTACTGCTCCTGCACCAAGGATCTGTGCAAC 360


6329R-3.IR_full       361 GGGGCCAACTCGCCTGCTGGCCAGTGGATGATGCTGCCCCTCATTGTGGCCGCCGGATTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6329R-3.in silico     361 GGGGCCAACTCGCCTGCTGGCCAGTGGATGATGCTGCCCCTCATTGTGGCCGCCGGATTG 420


6329R-3.IR_full       421 GCGCTCCTGCTGAACTCGAGGCACACAATACGATTCCAGAGCTCGT 466
                          ||||||||||||||||||||||||||||||||||||||||||||||
6329R-3.in silico     421 GCGCTCCTGCTGAACTCGAGGCACACAATACGATTCCAGAGCTCGT 466

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   448  NM_137060.2  CG6329-RC, transcript variant C (CG6329), mRNA 
100   448  NM_166011.2  CG6329-RA, transcript variant A (CG6329), mRNA 
100   448  NM_176169.1  CG6329-RD, transcript variant D (CG6329), mRNA 
100   448  NM_166012.2  CG6329-RB, transcript variant B (CG6329), mRNA 
0   NM_139548.2  CG12016-RA, transcript variant A (CG12016), mRNA 
0   NM_168022.1  CG12016-RB, transcript variant B (CG12016), mRNA 
0   NM_166958.1  CG3653-RA, transcript variant A (kirre), mRNA 
0   NM_080320.2  CG3653-RB, transcript variant B (kirre), mRNA 
0   NM_169202.1  CG11094-RA, transcript variant A (dsx), mRNA 
0   NM_169203.1  CG11094-RB, transcript variant B (dsx), mRNA 
0   NM_079548.4  CG11094-RC, transcript variant C (dsx), mRNA 
0   NM_079282.1  CG3322-RA (LanB2), mRNA 
0   NM_130721.1  CG2901-RA (CG2901), mRNA 
0   NM_140919.1  CG7385-RA (CG7385), mRNA 
0   NM_001014614.1  CG4067-RD, transcript variant D (pug), mRNA 
0   NM_169350.1  CG4067-RB, transcript variant B (pug), mRNA 
0   NM_057906.3  CG4067-RA, transcript variant A (pug), mRNA 
0   NM_169351.1  CG4067-RC, transcript variant C (pug), mRNA 
0   NM_078548.2  CG2985-RA (Yp1), mRNA 
0   NM_164526.1  CG9660-RB, transcript variant B (toc), mRNA 
0   NM_001038810.1  CG6647-RC, transcript variant C (porin), mRNA 
0   NM_134283.2  CG6647-RB, transcript variant B (porin), mRNA 
0   NM_057465.3  CG6647-RA, transcript variant A (porin), mRNA 
0   NM_079290.2  CG6721-RA, transcript variant A (Gap1), mRNA 
0   NM_168382.1  CG6721-RB, transcript variant B (Gap1), mRNA 
0   NM_137817.2  CG3413-RB, transcript variant B (wdp), mRNA 
0   NM_166526.1  CG3413-RD, transcript variant D (wdp), mRNA 
0   NM_143555.2  CG9717-RA (CG9717), mRNA 
0   NM_078719.2  CG11561-RA (smo), mRNA 
0   NM_132050.1  CG3011-RA (CG3011), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.