National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6281R-1 
 Symbol Timp  Full Name Tissue inhibitor of metalloproteases 
 CG No CG6281  Old CG No CG6281 
 Synonyms Dtimp, timp, CG6281, dTIMP, TIMP, DTIMP, Timp 
 Accession No (Link to NCBI) NM_079577.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGTTTATTGACGCTCCTCCTG 
 Primer Seq. 3'
aatctagaggtaccTCGCATTTTCCAAAAGGCGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GNTTTATTGA CGCTCCTCCT GGTCGCCGTT TTCNCGTTTT ACGGTCGCCC AGCGNATGNC 
0061 TGCAGCTGCA TGNNCATCNN ACCCACAGAC GCACTTCGCC CAGGCGNACT ACGTTGTGCA 
0121 ACTGCGAGTC CTTCGCAAAT CGGATACCAT CGAGCCCGGC AGGACCACCT ACAAAGNTCA 
0181 CATCAAACGC ACCTACAAGG CTACATCCGA AGCACGACGA ATGCTACGCG ATGGGCGCCT 
0241 GTCCACGCCC CAAGATGACG CAATGTGTGG TATAAATCTC GATCTGGGAA AAGTTTATAT 
0301 AGTAGCGGGT AGGNATGCCG ACATTAAATA TATGCAGCTA CTACAAGGAG TACACCAGGA 
0361 TGACCATAAC AGAGCGTCAT GGCTTCAGCG GTGGATATgN CAAGGCCACC ANTTGCACAG 
0421 TAACTCCCTG CTTTGGAGAG AGATGCTTTA AGGGACGAAA CTATGCCGAT ACATGCAAGT 
0481 GGTCGCCtTT TGGAAAATGC GA 
 in silico PCR Fragment
0001 GGTTTATTGA CGCTCCTCCT GGTCGCCGTT TTCGCGTTTT ACGGTCGCCC AGCGGATGCC 
0061 TGCAGCTGCA TG-CCATCTC ACCCACAGAC GCACTTCGCC CAGGCGGACT ACGTTGTGCA 
0121 ACTGCGAGTC CTTCGCAAAT CGGATACCAT CGAGCCCGGC AGGACCACCT ACAAAGTTCA 
0181 CATCAAACGC ACCTACAAGG CTACATCCGA AGCACGACGA ATGCTACGCG ATGGGCGCCT 
0241 GTCCACGCCC CAAGATGACG CAATGTGTGG TATAAATCTC GATCTGGGAA AAGTTTATAT 
0301 AGTAGCGGGT AGG-ATGCCG ACATTAAATA TATGCAGCTA CTACAAGGAG TACACCAGGA 
0361 TGACCATAAC AGAGCGTCAT GGCTTCAGCG GTGGATATGC CAAGGCCACC AATTGCACAG 
0421 TAACTCCCTG CTTTGGAGAG AGATGCTTTA AGGGACGAAA CTATGCCGAT ACATGCAAGT 
0481 GGTCGCCTTT TGGAAAATGC GA 
 Assemble Data

6281R-1.IR_full       1   GNTTTATTGACGCTCCTCCTGGTCGCCGTTTTCNCGTTTTACGGTCGCCCAGCGNATGNC 60
                          | ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
6281R-1.in silico     1   GGTTTATTGACGCTCCTCCTGGTCGCCGTTTTCGCGTTTTACGGTCGCCCAGCGGATGCC 60


6281R-1.IR_full       61  TGCAGCTGCATGNNCATCNNACCCACAGACGCACTTCGCCCAGGCGNACTACGTTGTGCA 120
                          ||||||||||||  ||||  |||||||||||||||||||||||||| |||||||||||||
6281R-1.in silico     61  TGCAGCTGCATG-CCATCTCACCCACAGACGCACTTCGCCCAGGCGGACTACGTTGTGCA 120


6281R-1.IR_full       121 ACTGCGAGTCCTTCGCAAATCGGATACCATCGAGCCCGGCAGGACCACCTACAAAGNTCA 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
6281R-1.in silico     121 ACTGCGAGTCCTTCGCAAATCGGATACCATCGAGCCCGGCAGGACCACCTACAAAGTTCA 180


6281R-1.IR_full       181 CATCAAACGCACCTACAAGGCTACATCCGAAGCACGACGAATGCTACGCGATGGGCGCCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6281R-1.in silico     181 CATCAAACGCACCTACAAGGCTACATCCGAAGCACGACGAATGCTACGCGATGGGCGCCT 240


6281R-1.IR_full       241 GTCCACGCCCCAAGATGACGCAATGTGTGGTATAAATCTCGATCTGGGAAAAGTTTATAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6281R-1.in silico     241 GTCCACGCCCCAAGATGACGCAATGTGTGGTATAAATCTCGATCTGGGAAAAGTTTATAT 300


6281R-1.IR_full       301 AGTAGCGGGTAGGNATGCCGACATTAAATATATGCAGCTACTACAAGGAGTACACCAGGA 360
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
6281R-1.in silico     301 AGTAGCGGGTAGG-ATGCCGACATTAAATATATGCAGCTACTACAAGGAGTACACCAGGA 360


6281R-1.IR_full       361 TGACCATAACAGAGCGTCATGGCTTCAGCGGTGGATATGNCAAGGCCACCANTTGCACAG 420
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||
6281R-1.in silico     361 TGACCATAACAGAGCGTCATGGCTTCAGCGGTGGATATGCCAAGGCCACCAATTGCACAG 420


6281R-1.IR_full       421 TAACTCCCTGCTTTGGAGAGAGATGCTTTAAGGGACGAAACTATGCCGATACATGCAAGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6281R-1.in silico     421 TAACTCCCTGCTTTGGAGAGAGATGCTTTAAGGGACGAAACTATGCCGATACATGCAAGT 480


6281R-1.IR_full       481 GGTCGCCTTTTGGAAAATGCGA 502
                          ||||||||||||||||||||||
6281R-1.in silico     481 GGTCGCCTTTTGGAAAATGCGA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169336.2  CG6281-RB, transcript variant B (Timp), mRNA 
100   482  NM_079577.3  CG6281-RA, transcript variant A (Timp), mRNA 
0   NM_143297.1  CG3361-RA (mrt), mRNA 
0   NM_134875.1  CG2975-RA (CG2975), mRNA 
0   NM_142131.1  CG7362-RA (CG7362), mRNA 
0   NM_165700.1  CG1623-RD, transcript variant D (CG1623), mRNA 
0   NM_165699.1  CG1623-RB, transcript variant B (CG1623), mRNA 
0   NM_132890.2  CG3692-RA (CalpC), mRNA 
0   NM_139905.2  CG8111-RA (CG8111), mRNA 
0   NM_169056.1  CG31550-RB, transcript variant B (CG31550), mRNA 
0   NM_169850.1  CG5558-RB, transcript variant B (CG5558), mRNA 
0   NM_142530.2  CG5558-RA, transcript variant A (CG5558), mRNA 
0   NM_141287.2  CG31550-RA, transcript variant A (CG31550), mRNA 
0   NM_078584.2  CG1848-RC, transcript variant C (LIMK1), mRNA 
0   NM_167326.1  CG1848-RA, transcript variant A (LIMK1), mRNA 
0   NM_167327.1  CG1848-RD, transcript variant D (LIMK1), mRNA 
0   NM_140036.1  CG4476-RB (CG4476), mRNA 
0   NM_137809.1  CG3292-RA (CG3292), mRNA 
0   NM_136651.1  CG1888-RA (CG1888), mRNA 
0   NM_137506.2  CG5489-RA, transcript variant A (Atg7), mRNA 
0   NM_166298.1  CG5489-RB, transcript variant B (Atg7), mRNA 
0   NM_001038975.1  CG6919-RB, transcript variant B (oa2), mRNA 
0   NM_167963.1  CG32297-RA (CG32297), mRNA 
0   NM_164941.1  CG17118-RA (CG17118), mRNA 
0   NM_057388.2  CG9224-RA (sog), mRNA 
0   NM_135449.2  CG3811-RB, transcript variant B (Oatp30B), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_205946.1  CG3811-RC, transcript variant C (Oatp30B), mRNA 
0   NM_164857.1  CG3811-RA, transcript variant A (Oatp30B), mRNA 
0   NM_079442.2  CG8522-RC, transcript variant C (HLH106), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.