National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6255R-1 
 Symbol CG6255  Full Name CG6255 
 CG No CG6255  Old CG No CG6255 
 Synonyms AAF55672, anon-WO0140519.197, CG6255 
 Accession No (Link to NCBI) NM_142552.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAATCGAGGAAGCAAGATGCTC 
 Primer Seq. 3'
aatctagaggtaccCCGGCATTATTCCGATTTTGC 
 Predicted Fragment Size
502 
 IR fragment full Seq
0001 AATCGAGGAA GCAAGATGCT CCTGCGGGCG ATGACGCCCC AAATTTTGAG GCGTGGCAAG 
0061 GCGGACTATG GCAAGACGGT GTGCAACCTG AAGATCAACA AGGCAACAAA GGTTCTAGTC 
0121 CAGGGATTCA CCGGCAAGCA GGCCACTTTC CACTCGGAGG AGTCCATAAA GTACGGAACC 
0181 AATATAGTTG GCGGTGTGAA TNCCCAAAAA GGGAGGTACG GAGCATCTGG GCAAGCCCGT 
0241 ATTCAAATCG GTGGCAGAAG CTGTGGAGAA GGCGAAGCCA GATGCCACGG TGATCTTTAT 
0301 ACCACCTCCA TNCCGCCGCC GAGGGTATTT GCGCGGCTAT CGAGAGTGAA ATTGGCTTGA 
0361 TTGTGGCCAT CACCGAGGGT ATTCCCCAGG CGGATATGGT GCGGATATCG CAAATGCTGA 
0421 ATTGCCAGGA GAAGTCCCGC CTGCTGGGAC CCAACTGTCC GGGAATCATC TCGCCGGATC 
0481 AGTGCAAAAT CGGAATAATN CCGG 
 in silico PCR Fragment
0001 AATCGAGGAA GCAAGATGCT CCTGCGGGCG TTAACGCCCC AAATTTTGAG GCGTGGCAAG 
0061 GCGGACTATG GCAAGACGGT GTGCAACCTG AAGATCAACA AGGCAACAAA GGTTCTAGTC 
0121 CAGGGATTCA CCGGCAAGCA GGCCACTTTC CACTCGGAGG AGTCCATAAA GTACGGAACC 
0181 AATATAGTTG GCGGTGTGAA T-CCCAAAAA GGGAGGTACG GAGCATCTGG GCAAGCCCGT 
0241 ATTCAAATCG GTGGCAGAAG CTGTGGAGAA GGCGAAGCCA GATGCCACGG TGATCTTTAT 
0301 ACCACCTCCA T-CCGCCGCC GAGGGTATTT GCGCGGCTAT CGAGAGTGAA ATTGGCTTGA 
0361 TTGTGGCCAT CACCGAGGGT ATTCCCCAGG CGGATATGGT GCGGATATCG CAAATGCTGA 
0421 ATTGCCAGGA GAAGTCCCGC CTGCTGGGAC CCAACTGTCC GGGAATCATC TCGCCGGATC 
0481 AGTGCAAAAT CGGAATAATG CCGG 
 Assemble Data

6255R-1.IR_full       1   AATCGAGGAAGCAAGATGCTCCTGCGGGCGATGACGCCCCAAATTTTGAGGCGTGGCAAG 60
                          |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||
6255R-1.in silico     1   AATCGAGGAAGCAAGATGCTCCTGCGGGCGTTAACGCCCCAAATTTTGAGGCGTGGCAAG 60


6255R-1.IR_full       61  GCGGACTATGGCAAGACGGTGTGCAACCTGAAGATCAACAAGGCAACAAAGGTTCTAGTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6255R-1.in silico     61  GCGGACTATGGCAAGACGGTGTGCAACCTGAAGATCAACAAGGCAACAAAGGTTCTAGTC 120


6255R-1.IR_full       121 CAGGGATTCACCGGCAAGCAGGCCACTTTCCACTCGGAGGAGTCCATAAAGTACGGAACC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6255R-1.in silico     121 CAGGGATTCACCGGCAAGCAGGCCACTTTCCACTCGGAGGAGTCCATAAAGTACGGAACC 180


6255R-1.IR_full       181 AATATAGTTGGCGGTGTGAATNCCCAAAAAGGGAGGTACGGAGCATCTGGGCAAGCCCGT 240
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
6255R-1.in silico     181 AATATAGTTGGCGGTGTGAAT-CCCAAAAAGGGAGGTACGGAGCATCTGGGCAAGCCCGT 240


6255R-1.IR_full       241 ATTCAAATCGGTGGCAGAAGCTGTGGAGAAGGCGAAGCCAGATGCCACGGTGATCTTTAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6255R-1.in silico     241 ATTCAAATCGGTGGCAGAAGCTGTGGAGAAGGCGAAGCCAGATGCCACGGTGATCTTTAT 300


6255R-1.IR_full       301 ACCACCTCCATNCCGCCGCCGAGGGTATTTGCGCGGCTATCGAGAGTGAAATTGGCTTGA 360
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
6255R-1.in silico     301 ACCACCTCCAT-CCGCCGCCGAGGGTATTTGCGCGGCTATCGAGAGTGAAATTGGCTTGA 360


6255R-1.IR_full       361 TTGTGGCCATCACCGAGGGTATTCCCCAGGCGGATATGGTGCGGATATCGCAAATGCTGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6255R-1.in silico     361 TTGTGGCCATCACCGAGGGTATTCCCCAGGCGGATATGGTGCGGATATCGCAAATGCTGA 420


6255R-1.IR_full       421 ATTGCCAGGAGAAGTCCCGCCTGCTGGGACCCAACTGTCCGGGAATCATCTCGCCGGATC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6255R-1.in silico     421 ATTGCCAGGAGAAGTCCCGCCTGCTGGGACCCAACTGTCCGGGAATCATCTCGCCGGATC 480


6255R-1.IR_full       481 AGTGCAAAATCGGAATAATNCCGG 504
                          ||||||||||||||||||| ||||
6255R-1.in silico     481 AGTGCAAAATCGGAATAATGCCGG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   484  NM_142552.2  CG6255-RA (CG6255), mRNA 
0   12  35  NM_079181.2  CG1065-RA (Scsalpha), mRNA 
0   NM_137070.1  CG16935-RA (CG16935), mRNA 
0   NM_167642.1  CG7893-RB, transcript variant B (vav), mRNA 
0   NM_133144.2  CG7893-RA, transcript variant A (vav), mRNA 
0   NM_142147.2  CG7262-RA (CG7262), mRNA 
0   NM_164684.1  CG31641-RA, transcript variant A (stai), mRNA 
0   NM_164682.1  CG31641-RC, transcript variant C (stai), mRNA 
0   NM_164683.1  CG31641-RB, transcript variant B (stai), mRNA 
0   NM_142149.1  CG7026-RA (CG7026), mRNA 
0   NM_141847.2  CG6834-RA (CG6834), mRNA 
0   NM_137793.1  CG13502-RA, transcript variant A (CG13502), mRNA 
0   NM_166506.1  CG13502-RB, transcript variant B (CG13502), mRNA 
0   NM_079229.1  CG8624-RA, transcript variant A (melt), mRNA 
0   NM_001014572.1  CG8624-RB, transcript variant B (melt), mRNA 
0   NM_137187.2  CG8160-RA (CG8160), mRNA 
0   NM_057266.4  CG4162-RA (lace), mRNA 
0   NM_136250.2  CG9247-RA (CG9247), mRNA 
0   NM_164887.1  CG31714-RA (CG31714), mRNA 
0   NM_134605.2  CG1696-RA (l(1)G0269), mRNA 
0   NM_001043266.1  CG34119-RA (CG34119), mRNA 
0   NM_142783.2  CG13849-RA (Nop56), mRNA 
0   NM_169857.1  CG31244-RA (CG31244), mRNA 
0   NM_166332.1  CG10737-RB, transcript variant B (CG10737), mRNA 
0   NM_166334.1  CG10737-RA, transcript variant A (CG10737), mRNA 
0   NM_166333.1  CG10737-RD, transcript variant D (CG10737), mRNA 
0   NM_001014538.1  CG10737-RE, transcript variant E (CG10737), mRNA 
0   NM_137554.2  CG10737-RC, transcript variant C (CG10737), mRNA 
0   NM_057507.3  CG8442-RA (Glu-RI), mRNA 
0   NM_139612.1  CG1308-RA (CG1308), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.