National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6224R-3 
 Symbol dbo  Full Name diablo 
 CG No CG6224  Old CG No CG6224 
 Synonyms Dm.DBO, DIABLO, Smac, CG6224, dbo 
 Accession No (Link to NCBI) NM_080250.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Strutt H, Searle E, Thomas-Macarthur V, Brookfield R, Strutt D.
A Cul-3-BTB ubiquitylation pathway regulates junctional levels and asymmetry of core planar polarity proteins.
Development (2013) 140(8) 1693-702 [ PubMed ID = 23487316 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTAAATATGCTACGGCGCCATC 
 Primer Seq. 3'
aatctagaggtaccGTTTAGCTCGTCGCTGCAAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TAAATATGCT ACGGCGCCAT CGGGAGCTCT GCGATGTGGT GCTCAACGTG GGCGGACGGA 
0061 AGATCTTTGC CCACCGGGTA ATCCTGTCCG CCTGCAGCTC CTACTTCTGT GCCATGTTCA 
0121 CTGGCGAATT GGAGGAATCG CGCCAGACTG AGGTCACCAT ACGCGACATC GATGAGAATG 
0181 CCATGGAGCT GCTCATCGAC TTTTGTTACA CCGCCCACAT AATCGTCGAG GAGTCGAATG 
0241 TCCAGACCCT CCTTCCCGCC GCCTGCCTGC TTCAACTGGT TGAGATTCAG GACATCTGCT 
0301 GCGAGTTCCT CAAACGGCAA TTGGATCCCA CCAACTGCCT GGGCATACGC GCCTTTGCCG 
0361 ACACACNACT CCTGCCGGGA ACTTCTACGG ATCGCCGACA AATTCACGCA GCACAACTTC 
0421 CAGGAGGTGA TGGAGAGCGA GGAGTTTCTG CTGCTCCCCG TCGGCCAGCT GGTGGACATC 
0481 ATTTGCAGCG ACGAGCTAAA C 
 in silico PCR Fragment
0001 TAAATATGCT ACGGCGCCAT CGGGAGCTCT GCGATGTGGT GCTCAACGTG GGCGGACGGA 
0061 AGATCTTTGC CCACCGGGTA ATCCTGTCCG CCTGCAGCTC CTACTTCTGT GCCATGTTCA 
0121 CTGGCGAATT GGAGGAATCG CGCCAGACTG AGGTCACCAT ACGCGACATC GATGAGAATG 
0181 CCATGGAGCT GCTCATCGAC TTTTGTTACA CCGCCCACAT AATCGTCGAG GAGTCGAATG 
0241 TCCAGACCCT CCTTCCCGCC GCCTGCCTGC TTCAACTGGT TGAGATTCAG GACATCTGCT 
0301 GCGAGTTCCT CAAACGGCAA TTGGATCCCA CCAACTGCCT GGGCATACGC GCCTTTGCCG 
0361 ACACAC-ACT CCTGCCGGGA ACTTCTACGG ATCGCCGACA AATTCACGCA GCACAACTTC 
0421 CAGGAGGTGA TGGAGAGCGA GGAGTTTCTG CTGCTCCCCG TCGGCCAGCT GGTGGACATC 
0481 ATTTGCAGCG ACGAGCTAAA C 
 Assemble Data

6224R-3.IR_full       1   TAAATATGCTACGGCGCCATCGGGAGCTCTGCGATGTGGTGCTCAACGTGGGCGGACGGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6224R-3.in silico     1   TAAATATGCTACGGCGCCATCGGGAGCTCTGCGATGTGGTGCTCAACGTGGGCGGACGGA 60


6224R-3.IR_full       61  AGATCTTTGCCCACCGGGTAATCCTGTCCGCCTGCAGCTCCTACTTCTGTGCCATGTTCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6224R-3.in silico     61  AGATCTTTGCCCACCGGGTAATCCTGTCCGCCTGCAGCTCCTACTTCTGTGCCATGTTCA 120


6224R-3.IR_full       121 CTGGCGAATTGGAGGAATCGCGCCAGACTGAGGTCACCATACGCGACATCGATGAGAATG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6224R-3.in silico     121 CTGGCGAATTGGAGGAATCGCGCCAGACTGAGGTCACCATACGCGACATCGATGAGAATG 180


6224R-3.IR_full       181 CCATGGAGCTGCTCATCGACTTTTGTTACACCGCCCACATAATCGTCGAGGAGTCGAATG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6224R-3.in silico     181 CCATGGAGCTGCTCATCGACTTTTGTTACACCGCCCACATAATCGTCGAGGAGTCGAATG 240


6224R-3.IR_full       241 TCCAGACCCTCCTTCCCGCCGCCTGCCTGCTTCAACTGGTTGAGATTCAGGACATCTGCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6224R-3.in silico     241 TCCAGACCCTCCTTCCCGCCGCCTGCCTGCTTCAACTGGTTGAGATTCAGGACATCTGCT 300


6224R-3.IR_full       301 GCGAGTTCCTCAAACGGCAATTGGATCCCACCAACTGCCTGGGCATACGCGCCTTTGCCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6224R-3.in silico     301 GCGAGTTCCTCAAACGGCAATTGGATCCCACCAACTGCCTGGGCATACGCGCCTTTGCCG 360


6224R-3.IR_full       361 ACACACNACTCCTGCCGGGAACTTCTACGGATCGCCGACAAATTCACGCAGCACAACTTC 420
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
6224R-3.in silico     361 ACACAC-ACTCCTGCCGGGAACTTCTACGGATCGCCGACAAATTCACGCAGCACAACTTC 420


6224R-3.IR_full       421 CAGGAGGTGATGGAGAGCGAGGAGTTTCTGCTGCTCCCCGTCGGCCAGCTGGTGGACATC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6224R-3.in silico     421 CAGGAGGTGATGGAGAGCGAGGAGTTTCTGCTGCTCCCCGTCGGCCAGCTGGTGGACATC 480


6224R-3.IR_full       481 ATTTGCAGCGACGAGCTAAAC 501
                          |||||||||||||||||||||
6224R-3.in silico     481 ATTTGCAGCGACGAGCTAAAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080250.2  CG6224-RA (dbo), mRNA 
0   NM_057241.2  CG7210-RB, transcript variant B (kel), mRNA 
0   NM_165242.1  CG7210-RA, transcript variant A (kel), mRNA 
0   NM_164768.1  CG31904-RB, transcript variant B (CG31904), mRNA 
0   NM_164769.1  CG31904-RD, transcript variant D (CG31904), mRNA 
0   NM_164766.1  CG13796-RB, transcript variant B (CG13796), mRNA 
0   NM_135296.1  CG13796-RA, transcript variant A (CG13796), mRNA 
0   NM_164767.1  CG13796-RC, transcript variant C (CG13796), mRNA 
0   19  NM_137533.3  CG15097-RA, transcript variant A (CG15097), mRNA 
0   19  NM_176232.1  CG15097-RB, transcript variant B (CG15097), mRNA 
0   13  NM_139732.2  CG10542-RA (CG10542), mRNA 
0   NM_167990.1  CG11494-RA, transcript variant A (BtbVII), mRNA 
0   NM_079172.2  CG11494-RB, transcript variant B (BtbVII), mRNA 
0   NM_141524.1  CG9626-RA (CG9626), mRNA 
0   NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0   NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0   NM_168126.1  CG5406-RB, transcript variant B (sif), mRNA 
0   NM_139448.2  CG32300-RB (oxt), mRNA 
0   NM_142958.2  CG13607-RA (CG13607), mRNA 
0   NM_165148.1  CG31819-RA (CG31819), mRNA 
0   11  NM_168153.1  CG32406-RA (CG32406), mRNA 
0   NM_132125.1  CG4536-RA (CG4536), mRNA 
0   NM_140926.1  CG13811-RA (CG13811), mRNA 
0   11  NM_168064.2  CG14998-RA, transcript variant A (CG14998), mRNA 
0   11  NM_168063.2  CG14998-RD, transcript variant D (CG14998), mRNA 
0   11  NM_168062.2  CG14998-RE, transcript variant E (CG14998), mRNA 
0   11  NM_168061.2  CG14998-RB, transcript variant B (CG14998), mRNA 
0   11  NM_139604.2  CG14998-RC, transcript variant C (CG14998), mRNA 
0   10  NM_078664.2  CG5870-RA (beta-Spec), mRNA 
0   NM_057214.3  CG4807-RA, transcript variant A (ab), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.