National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6215R-1 
 Symbol CkIIalpha-i1  Full Name CKII-alpha subunit interactor-1 
 CG No CG6215  Old CG No CG6215 
 Synonyms CKIIalpha-I1, CkIIalpha-i1, CG6215 
 Accession No (Link to NCBI) NM_079372.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGATCGATCTCGAGAAGCCC 
 Primer Seq. 3'
aatctagaggtaccTCGAGCACATGGCCGCAACAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NAGATCGATC TCGAGAAGCC CAAATTCAAA TCGGCCAATA AACTGCTGCA AAGACTTTTC 
0061 GATTGGTACA AAATTGATGC TGCTATCCTG GGGGAAAATT ACTGCATTTG CGAGCCCTGC 
0121 TTTGGAGAGA CTTTGCGCAT AAGCGAATCC CTGGAGAAGT GGGGCACGGC CCAGGNACGA 
0181 GTTTCACCGG AGGCCCATCG AAATAGACGA CTCCACTGCA TTTCAGATCA AGTTGGAGGT 
0241 GACATCAAAC AAAGAAGAGG TAGAAACGGA AAAGAATGAT GAGGAGAATT CTTTCGATCA 
0301 GCATATCGCG GAGCCAGNTG AAGGAAGATC CATTGGAAAA AAAACGAGCA TATGGAGATC 
0361 GTAGTCGAAG AATCTTTGAA AACCGCGTCC GTGGATTTCT TCAGCGTGGG ATTGTCACGC 
0421 GATGGCTTGG CAGTCACCAA GTTCTTCAAG GACAAGACCC AAGCCACTCG GATGCTGTGC 
0481 ACCTGTTGCG GCCATGTGCT CGA 
 in silico PCR Fragment
0001 GAGATCGATC TCGAGAAGCC CAAATTCAAA TCGGCCAATA AACTGCTGCA AAGACTTTTC 
0061 GATTGGTACA AAATTGATGC TGCTATCCTG GGGGAAAATT ACTGCATTTG CGAGCCCTGC 
0121 TTTGGAGAGA CTTTGCGCAT AAGCGAATCC CTGGAGAAGT GGGGCACGGC CCAGG-ACGA 
0181 GTTTCACCGG AGGCCCATCG AAATAGACGA CTCCACTGCA TTTCAGATCA AGTTGGAGGT 
0241 GACATCAAAC AAAGAAGAGG TAGAAACGGA AAAGAATGAT GAGGAGAATT CTTTCGATCA 
0301 GCATATCGCG GAGCCAG-TG AAGGAAGATC CATTGG-AAA AAAACGAGCA TATGGAGATC 
0361 GTAGTCGAAG AATCTTTGAA AACCGCGTCC GTGGATTTCT TCAGCGTGGG ATTGTCACGC 
0421 GATGGCTTGG CAGTCACCAA GTTCTTCAAG GACAAGACCC AAGCCACTCG GATGCTGTGC 
0481 ACCTGTTGCG GCCATGTGCT CGA 
 Assemble Data

6215R-1.IR_full        1   AGATCGATCTCGAGAAGCCCAAATTCAAATCGGCCAATAAACTGCTGCAAAGACTTTTC 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6215R-1.in silico      1   AGATCGATCTCGAGAAGCCCAAATTCAAATCGGCCAATAAACTGCTGCAAAGACTTTTC 59


6215R-1.IR_full       61  GATTGGTACAAAATTGATGCTGCTATCCTGGGGGAAAATTACTGCATTTGCGAGCCCTGC 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6215R-1.in silico     61  GATTGGTACAAAATTGATGCTGCTATCCTGGGGGAAAATTACTGCATTTGCGAGCCCTGC 119


6215R-1.IR_full       121 TTTGGAGAGACTTTGCGCATAAGCGAATCCCTGGAGAAGTGGGGCACGGCCCAGGNACGA 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
6215R-1.in silico     121 TTTGGAGAGACTTTGCGCATAAGCGAATCCCTGGAGAAGTGGGGCACGGCCCAGG-ACGA 179


6215R-1.IR_full       181 GTTTCACCGGAGGCCCATCGAAATAGACGACTCCACTGCATTTCAGATCAAGTTGGAGGT 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6215R-1.in silico     181 GTTTCACCGGAGGCCCATCGAAATAGACGACTCCACTGCATTTCAGATCAAGTTGGAGGT 239


6215R-1.IR_full       241 GACATCAAACAAAGAAGAGGTAGAAACGGAAAAGAATGATGAGGAGAATTCTTTCGATCA 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6215R-1.in silico     241 GACATCAAACAAAGAAGAGGTAGAAACGGAAAAGAATGATGAGGAGAATTCTTTCGATCA 299


6215R-1.IR_full       301 GCATATCGCGGAGCCAGNTGAAGGAAGATCCATTGGAAAAAAAACGAGCATATGGAGATC 359
                          ||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||
6215R-1.in silico     301 GCATATCGCGGAGCCAG-TGAAGGAAGATCCATTGG-AAAAAAACGAGCATATGGAGATC 359


6215R-1.IR_full       361 GTAGTCGAAGAATCTTTGAAAACCGCGTCCGTGGATTTCTTCAGCGTGGGATTGTCACGC 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6215R-1.in silico     361 GTAGTCGAAGAATCTTTGAAAACCGCGTCCGTGGATTTCTTCAGCGTGGGATTGTCACGC 419


6215R-1.IR_full       421 GATGGCTTGGCAGTCACCAAGTTCTTCAAGGACAAGACCCAAGCCACTCGGATGCTGTGC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6215R-1.in silico     421 GATGGCTTGGCAGTCACCAAGTTCTTCAAGGACAAGACCCAAGCCACTCGGATGCTGTGC 479


6215R-1.IR_full       481 ACCTGTTGCGGCCATGTGCTCGA 502
                          |||||||||||||||||||||||
6215R-1.in silico     481 ACCTGTTGCGGCCATGTGCTCGA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079372.2  CG6215-RA (CkIIalpha-i1), mRNA 
0   28  44  NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   NM_001043293.1  CG34103-RA (BG642167), mRNA 
0   NM_132133.1  CG3044-RA (CG3044), mRNA 
0   NM_057597.2  CG10719-RA, transcript variant A (brat), mRNA 
0   NM_167235.1  CG32680-RB (CG32680), mRNA 
0   NM_079079.2  CG9709-RA (Acox57D-d), mRNA 
0   NM_165220.1  CG6605-RA (BicD), mRNA 
0   NM_205871.2  CG2381-RF, transcript variant F (Syt7), mRNA 
0   NM_143659.3  CG2381-RC, transcript variant C (Syt7), mRNA 
0   NM_166751.3  CG2381-RE, transcript variant E (Syt7), mRNA 
0   NM_166748.3  CG2381-RA, transcript variant A (Syt7), mRNA 
0   NM_166749.1  CG2381-RB, transcript variant B (Syt7), mRNA 
0   NM_001014686.1  CG2381-RG, transcript variant G (Syt7), mRNA 
0   NM_135096.1  CG18269-RA (CG18269), mRNA 
0   NM_163892.1  CG32491-RS, transcript variant S (mod(mdg4)), mRNA 
0   NM_135766.2  CG16974-RA (CG16974), mRNA 
0   NM_132773.2  CG5627-RA (rab3-GEF), mRNA 
0   NM_132903.1  CG9906-RA (CG9906), mRNA 
0   NM_142303.2  CG14891-RA, transcript variant A (CG14891), mRNA 
0   NM_169723.1  CG14891-RB, transcript variant B (CG14891), mRNA 
0   NM_078795.2  CG18241-RA (Toll-4), mRNA 
0   NM_165341.1  CG1768-RB, transcript variant B (dia), mRNA 
0   NM_137240.2  CG8414-RA (CG8414), mRNA 
0   NM_057633.3  CG1768-RA, transcript variant A (dia), mRNA 
0   NM_001014600.1  CG14457-RB, transcript variant B (CG14457), mRNA 
0   NM_141144.2  CG14457-RA, transcript variant A (CG14457), mRNA 
0   NM_143318.2  CG31057-RA (tau), mRNA 
0   NM_176229.1  CG33147-RA (CG33147), mRNA 
0   NM_001042864.1  CG9660-RE, transcript variant E (toc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.