National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6189R-3 
 Symbol l(1)1Bi  Full Name lethal (1) 1Bi 
 CG No CG6189  Old CG No CG6189 
 Synonyms l(1)lBi, EG:115C2.2, CG6189, l(1)Bi, HM-52, HM-419, l(1)1Bi 
 Accession No (Link to NCBI) NM_057245.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGACAAAGGCCAAGGAGGAC 
 Primer Seq. 3'
aatctagaggtaccGCTGTAACCAATTGACCGACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGACAAAGG CCAAGGAGGA CCGCAAGCGG GCAAAAACTC AAAAATCCGA AGCGGACTCG 
0061 CAAATACCGG CCAAGATTTT GAAGAAGTCC AAGAAGGAGA AGCCGGCGGA GACCGAGNGA 
0121 AAAGGAAAAT ACCGCAAGCA ACGCCAACCT GAAGGTGTCT CAGATCAACA AGGCCGTTTT 
0181 TGTGGTCTTC AAAAAGATGC AGGGCAGTCA ACTGACCAAG AAGATGATCA ATTCGCTCAT 
0241 AACANCTGCT GCGCGATGAT ACAAATGCTG AGCAGCNCAC TGCGACCACC GGCTACGTGC 
0301 TCAAGCGCCT GATCCGCTCC ACAGGAGCAG ATGACATGAA GACGGTGAGC CTGGCCGCCA 
0361 GTTACATACA CTGCATCCTA AACGCCGTGC CCGCCATTGA TGCTTTTGAG GTTCTGGAGA 
0421 CTCTGAAGCG AGACCTGGCC GTTGGCAGCC AGCAGAGGGG CAAGGAGGAC TCACTAGCGG 
0481 CCGTCGGTCA ATTGGTTACA GC 
 in silico PCR Fragment
0001 AAGACAAAGG CCAAGGAGGA CCGCAAGCGG GCAAAAACTC AAAAATCCGA AGCGGACTCG 
0061 CAAATACCGG CCAAGATTTT GAAGAAGTCC AAGAAGGAGA AGCCGGCGGA GACCGAG-GA 
0121 AAAGGAAAAT ACCGCAAGCA ACGCCAACCT GAAGGTGTCT CAGATCAACA AGGCCGTTTT 
0181 TGTGGTCTTC AAAAAGATGC AGGGCAGTCA ACTGACCAAG AAGATGATCA ATTCGCTCAT 
0241 AACA-CTGCT GCGCGATGAT ACAAATGCTG AGCAGCGCAC TGCGACCACC GGCTACGTGC 
0301 TCAAGCGCCT GATCCGCTCC ACAGGAGCAG ATGACATGAA GACGGTGAGC CTGGCCGCCA 
0361 GTTACATACA CTGCATCCTA AACGCCGTGC CCGCCATTGA TGCTTTTGAG GTTCTGGAGA 
0421 CTCTGAAGCG AGACCTGGCC GTTGGCAGCC AGCAGAGGGG CAAGGAGGAC TCACTAGCGG 
0481 CCGTCGGTCA ATTGGTTACA GC 
 Assemble Data

6189R-3.IR_full       1   AAGACAAAGGCCAAGGAGGACCGCAAGCGGGCAAAAACTCAAAAATCCGAAGCGGACTCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6189R-3.in silico     1   AAGACAAAGGCCAAGGAGGACCGCAAGCGGGCAAAAACTCAAAAATCCGAAGCGGACTCG 60


6189R-3.IR_full       61  CAAATACCGGCCAAGATTTTGAAGAAGTCCAAGAAGGAGAAGCCGGCGGAGACCGAGNGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
6189R-3.in silico     61  CAAATACCGGCCAAGATTTTGAAGAAGTCCAAGAAGGAGAAGCCGGCGGAGACCGAG-GA 120


6189R-3.IR_full       121 AAAGGAAAATACCGCAAGCAACGCCAACCTGAAGGTGTCTCAGATCAACAAGGCCGTTTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6189R-3.in silico     121 AAAGGAAAATACCGCAAGCAACGCCAACCTGAAGGTGTCTCAGATCAACAAGGCCGTTTT 180


6189R-3.IR_full       181 TGTGGTCTTCAAAAAGATGCAGGGCAGTCAACTGACCAAGAAGATGATCAATTCGCTCAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6189R-3.in silico     181 TGTGGTCTTCAAAAAGATGCAGGGCAGTCAACTGACCAAGAAGATGATCAATTCGCTCAT 240


6189R-3.IR_full       241 AACANCTGCTGCGCGATGATACAAATGCTGAGCAGCNCACTGCGACCACCGGCTACGTGC 300
                          |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||
6189R-3.in silico     241 AACA-CTGCTGCGCGATGATACAAATGCTGAGCAGCGCACTGCGACCACCGGCTACGTGC 300


6189R-3.IR_full       301 TCAAGCGCCTGATCCGCTCCACAGGAGCAGATGACATGAAGACGGTGAGCCTGGCCGCCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6189R-3.in silico     301 TCAAGCGCCTGATCCGCTCCACAGGAGCAGATGACATGAAGACGGTGAGCCTGGCCGCCA 360


6189R-3.IR_full       361 GTTACATACACTGCATCCTAAACGCCGTGCCCGCCATTGATGCTTTTGAGGTTCTGGAGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6189R-3.in silico     361 GTTACATACACTGCATCCTAAACGCCGTGCCCGCCATTGATGCTTTTGAGGTTCTGGAGA 420


6189R-3.IR_full       421 CTCTGAAGCGAGACCTGGCCGTTGGCAGCCAGCAGAGGGGCAAGGAGGACTCACTAGCGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6189R-3.in silico     421 CTCTGAAGCGAGACCTGGCCGTTGGCAGCCAGCAGAGGGGCAAGGAGGACTCACTAGCGG 480


6189R-3.IR_full       481 CCGTCGGTCAATTGGTTACAGC 502
                          ||||||||||||||||||||||
6189R-3.in silico     481 CCGTCGGTCAATTGGTTACAGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057245.2  CG6189-RA (l(1)1Bi), mRNA 
0   NM_143283.1  CG5882-RA (CG5882), mRNA 
0   10  NM_170467.1  CG31025-RB, transcript variant B (CG31025), mRNA 
0   10  NM_170466.1  CG31025-RA, transcript variant A (CG31025), mRNA 
0   NM_166087.1  CG8153-RC, transcript variant C (mus210), mRNA 
0   NM_057513.3  CG8153-RA, transcript variant A (mus210), mRNA 
0   NM_057514.3  CG8153-RB, transcript variant B (mus210), mRNA 
0   NM_168961.2  CG32451-RB, transcript variant B (SPoCk), mRNA 
0   NM_168963.1  CG32451-RA, transcript variant A (SPoCk), mRNA 
0   NM_168962.1  CG32451-RC, transcript variant C (SPoCk), mRNA 
0   NM_130725.2  CG15239-RA (CG15239), mRNA 
0   NM_134696.1  CG2839-RA (CG2839), mRNA 
0   NM_143292.1  CG5987-RA (CG5987), mRNA 
0   NM_132320.2  CG12124-RA (CG12124), mRNA 
0   NM_136003.2  CG6412-RA (CG6412), mRNA 
0   NM_142560.2  CG17752-RA (CG17752), mRNA 
0   NM_167252.1  CG1691-RG, transcript variant G (Imp), mRNA 
0   NM_167249.1  CG1691-RD, transcript variant D (Imp), mRNA 
0   NM_167250.1  CG1691-RE, transcript variant E (Imp), mRNA 
0   NM_167251.1  CG1691-RF, transcript variant F (Imp), mRNA 
0   NM_167253.1  CG1691-RH, transcript variant H (Imp), mRNA 
0   15  NM_175960.3  CG33196-RB (dp), mRNA 
0   10  NM_142520.2  CG6013-RA (CG6013), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   17  NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   17  NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   17  NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   17  NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   NM_166938.1  CG2841-RC, transcript variant C (ptr), mRNA 
0   NM_166937.1  CG2841-RA, transcript variant A (ptr), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
++ 
DB
++ 
DC
++ 
DM
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
VB
++ 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.