National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6138R-3 
 Symbol CG6138  Full Name CG6138 
 CG No CG6138  Old CG No CG6138 
 Synonyms BcDNA:AT25107, CG6138 
 Accession No (Link to NCBI) NM_164936.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATGCGTGAATCCTTCAAGAC 
 Primer Seq. 3'
aatctagaggtaccTGTAATACTGTATCTGCGCCC 
 Predicted Fragment Size
463 
 IR fragment full Seq
0001 NATGCGTGAA TCCTTCAAGA CGCTGCAGAA GCTCCTgcgG CGCNNTTCGC TGCCCGTAGA 
0061 GGAGAGTCTG CGTTCCATGC CGAGATCGAA AGCTGGAGGT CAACTGGAGG CATTGCCATC 
0121 CTTGCTGCCT ATTGTGGACA ACAATTACGA GAGGACCAGC GATAAGGCGT GGAACTCGGC 
0181 GGAANAGCGG AGCCCGTTCG TCGCCCATCA TTTCGGAGTG CGGCCTGGGT GATTGGGATA 
0241 AGGAGGATCC TTCAGATCCT TCAGATAGGG CACTGGTGCC CTACGAGGAA CTGGGCAATG 
0301 ANCGAAGCAG TTCGGACACC ACAATCACCA GCCgTAGCTT CGCATCGTCG GGAATCTCGC 
0361 TCAGCATACC TGTTCACTTG GTATGGAACA ACAAAGAGTA CAATCAGGAG AGCACGGACA 
0421 GTGAAACTAC ACTTATAGCG GACGGGCGCA GATACAGTAT TACA 
 in silico PCR Fragment
0001 GATGCGTGAA TCCTTCAAGA CGCTGCAGAA GCTCCTGCGG CGCAGTTCGC TGCCCGTAGA 
0061 GGAGAGTCTG CGTTCCATGC CGAGATCGAA AGCTGGAGGT CAACTGGAGG CATTGCCATC 
0121 CTTGCTGCCT ATTGTGGACA ACAATTACGA GAGGACCAGC GATAAGGCGT GGAACTCGGC 
0181 GGAA-AGCGG AGCCCGTTCG TCGCCCATCA TTTCGGAGTG CGGCCTGGGT GATTGGGATA 
0241 AGGAGGATCC TTCAGATCCT TCAGATAGGG CACTGGTGCC CTACGAGGAA CTGGGCAATG 
0301 AGCGAAGCAG TTCGGACACC ACAATCACCA GCCGTAGCTT CGCATCGTCG GGAATCTCGC 
0361 TCAGCATACC TGTTCACTTG GTATGGAACA ACAAAGAGTA CAATCAGGAG AGCACGGACA 
0421 GTGAAACTAC ACTTATAGCG GACGGGCGCA GATACAGTAT TACA 
 Assemble Data

6138R-3.IR_full        1   ATGCGTGAATCCTTCAAGACGCTGCAGAAGCTCCTGCGGCGCNNTTCGCTGCCCGTAGA 59
                           ||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||
6138R-3.in silico      1   ATGCGTGAATCCTTCAAGACGCTGCAGAAGCTCCTGCGGCGCAGTTCGCTGCCCGTAGA 59


6138R-3.IR_full       61  GGAGAGTCTGCGTTCCATGCCGAGATCGAAAGCTGGAGGTCAACTGGAGGCATTGCCATC 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6138R-3.in silico     61  GGAGAGTCTGCGTTCCATGCCGAGATCGAAAGCTGGAGGTCAACTGGAGGCATTGCCATC 119


6138R-3.IR_full       121 CTTGCTGCCTATTGTGGACAACAATTACGAGAGGACCAGCGATAAGGCGTGGAACTCGGC 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6138R-3.in silico     121 CTTGCTGCCTATTGTGGACAACAATTACGAGAGGACCAGCGATAAGGCGTGGAACTCGGC 179


6138R-3.IR_full       181 GGAANAGCGGAGCCCGTTCGTCGCCCATCATTTCGGAGTGCGGCCTGGGTGATTGGGATA 239
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
6138R-3.in silico     181 GGAA-AGCGGAGCCCGTTCGTCGCCCATCATTTCGGAGTGCGGCCTGGGTGATTGGGATA 239


6138R-3.IR_full       241 AGGAGGATCCTTCAGATCCTTCAGATAGGGCACTGGTGCCCTACGAGGAACTGGGCAATG 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6138R-3.in silico     241 AGGAGGATCCTTCAGATCCTTCAGATAGGGCACTGGTGCCCTACGAGGAACTGGGCAATG 299


6138R-3.IR_full       301 ANCGAAGCAGTTCGGACACCACAATCACCAGCCGTAGCTTCGCATCGTCGGGAATCTCGC 359
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6138R-3.in silico     301 AGCGAAGCAGTTCGGACACCACAATCACCAGCCGTAGCTTCGCATCGTCGGGAATCTCGC 359


6138R-3.IR_full       361 TCAGCATACCTGTTCACTTGGTATGGAACAACAAAGAGTACAATCAGGAGAGCACGGACA 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6138R-3.in silico     361 TCAGCATACCTGTTCACTTGGTATGGAACAACAAAGAGTACAATCAGGAGAGCACGGACA 419


6138R-3.IR_full       421 GTGAAACTACACTTATAGCGGACGGGCGCAGATACAGTATTACA 463
                          ||||||||||||||||||||||||||||||||||||||||||||
6138R-3.in silico     421 GTGAAACTACACTTATAGCGGACGGGCGCAGATACAGTATTACA 463

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   445  NM_164936.1  CG6138-RA, transcript variant A (CG6138), mRNA 
90.33   402  NM_135578.2  CG6138-RB, transcript variant B (CG6138), mRNA 
0   NM_140982.1  CG5059-RA, transcript variant A (CG5059), mRNA 
0   NM_206403.1  CG5059-RD, transcript variant D (CG5059), mRNA 
0   NM_168865.1  CG5059-RC, transcript variant C (CG5059), mRNA 
0   NM_168864.1  CG5059-RB, transcript variant B (CG5059), mRNA 
0   NM_142695.1  CG5810-RA (CG5810), mRNA 
0   NM_167994.1  CG32280-RC, transcript variant C (CG32280), mRNA 
0   NM_167992.1  CG32280-RA, transcript variant A (CG32280), mRNA 
0   NM_167993.1  CG32280-RB, transcript variant B (CG32280), mRNA 
0   NM_137282.1  CG4398-RA (CG4398), mRNA 
0   NM_137721.1  CG18375-RA, transcript variant A (CG18375), mRNA 
0   NM_176243.1  CG18375-RB, transcript variant B (CG18375), mRNA 
0   NM_130706.2  CG10802-RA (CG10802), mRNA 
0   NM_165550.1  CG30493-RB (CG30493), mRNA 
0   NM_132755.1  CG9509-RA (CG9509), mRNA 
0   NM_170175.1  CG31105-RA (CG31105), mRNA 
0   NM_132591.3  CG17762-RB, transcript variant B (tomosyn), mRNA 
0   NM_167328.2  CG17762-RA, transcript variant A (tomosyn), mRNA 
0   NM_167329.2  CG17762-RC, transcript variant C (tomosyn), mRNA 
0   NM_167330.2  CG17762-RD, transcript variant D (tomosyn), mRNA 
0   NM_142147.2  CG7262-RA (CG7262), mRNA 
0   NM_141820.1  CG17230-RA, transcript variant A (CG17230), mRNA 
0   NM_169394.1  CG17230-RB, transcript variant B (CG17230), mRNA 
0   NM_141964.2  CG6225-RA (CG6225), mRNA 
0   NR_003121.1  CG6225-RA (CG6225), mRNA, snRNA 
0   NM_078589.2  CG1903-RB, transcript variant B (sno), mRNA 
0   NM_167353.1  CG1903-RA, transcript variant A (sno), mRNA 
0   NM_143315.1  CG5612-RA (CG5612), mRNA 
0   NM_078764.2  CG11607-RA (H2.0), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
DM
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.