National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6138R-1 
 Symbol CG6138  Full Name CG6138 
 CG No CG6138  Old CG No CG6138 
 Synonyms BcDNA:AT25107, CG6138 
 Accession No (Link to NCBI) NM_164936.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||| silico      1   ATGCGTGAATCCTTCAAGACGCTGCAGAAGCTCCTGCGGCGCAGTTCGCTGCCCGTAGA 59

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGAGAGTCTGCGTTCCATGCCGAGATCGAAAGCTGGAGGTCAACTGGAGGCATTGCCATC 119

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CTTGCTGCCTATTGTGGACAACAATTACGAGAGGACCAGCGATAAGGCGTGGAACTCGGC 179

                          |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGAA-AGCGGAGCCCGTTCGTCGCCCATCATTTCGGAGTGCGGCCTGGGTGATTGGGATA 239

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGGAGGATCCTTCAGATCCTTCAGATAGGGCACTGGTGCCCTACGAGGAACTGGGCAATG 299

                          | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGCGAAGCAGTTCGGACACCACAATCACCAGCCGTAGCTTCGCATCGTCGGGAATCTCGC 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCAGCATACCTGTTCACTTGGTATGGAACAACAAAGAGTACAATCAGGAGAGCACGGACA 419

                          |||||||||||||||||||||||||||||||||||||||||||| silico     421 GTGAAACTACACTTATAGCGGACGGGCGCAGATACAGTATTACA 463

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   445  NM_164936.1  CG6138-RA, transcript variant A (CG6138), mRNA 
90.33   402  NM_135578.2  CG6138-RB, transcript variant B (CG6138), mRNA 
0   NM_140982.1  CG5059-RA, transcript variant A (CG5059), mRNA 
0   NM_206403.1  CG5059-RD, transcript variant D (CG5059), mRNA 
0   NM_168865.1  CG5059-RC, transcript variant C (CG5059), mRNA 
0   NM_168864.1  CG5059-RB, transcript variant B (CG5059), mRNA 
0   NM_142695.1  CG5810-RA (CG5810), mRNA 
0   NM_167994.1  CG32280-RC, transcript variant C (CG32280), mRNA 
0   NM_167992.1  CG32280-RA, transcript variant A (CG32280), mRNA 
0   NM_167993.1  CG32280-RB, transcript variant B (CG32280), mRNA 
0   NM_137282.1  CG4398-RA (CG4398), mRNA 
0   NM_137721.1  CG18375-RA, transcript variant A (CG18375), mRNA 
0   NM_176243.1  CG18375-RB, transcript variant B (CG18375), mRNA 
0   NM_130706.2  CG10802-RA (CG10802), mRNA 
0   NM_165550.1  CG30493-RB (CG30493), mRNA 
0   NM_132755.1  CG9509-RA (CG9509), mRNA 
0   NM_170175.1  CG31105-RA (CG31105), mRNA 
0   NM_132591.3  CG17762-RB, transcript variant B (tomosyn), mRNA 
0   NM_167328.2  CG17762-RA, transcript variant A (tomosyn), mRNA 
0   NM_167329.2  CG17762-RC, transcript variant C (tomosyn), mRNA 
0   NM_167330.2  CG17762-RD, transcript variant D (tomosyn), mRNA 
0   NM_142147.2  CG7262-RA (CG7262), mRNA 
0   NM_141820.1  CG17230-RA, transcript variant A (CG17230), mRNA 
0   NM_169394.1  CG17230-RB, transcript variant B (CG17230), mRNA 
0   NM_141964.2  CG6225-RA (CG6225), mRNA 
0   NR_003121.1  CG6225-RA (CG6225), mRNA, snRNA 
0   NM_078589.2  CG1903-RB, transcript variant B (sno), mRNA 
0   NM_167353.1  CG1903-RA, transcript variant A (sno), mRNA 
0   NM_143315.1  CG5612-RA (CG5612), mRNA 
0   NM_078764.2  CG11607-RA (H2.0), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.