National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6133R-3 
 Symbol CG6133  Full Name CG6133 
 CG No CG6133  Old CG No CG6133 
 Synonyms EG:EG0007.9, CG6133 
 Accession No (Link to NCBI) NM_143750.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCGCGGCTCGCAAACGTCAAAAGCGGGAGAATGGTCCCAAGCGCACCGATCGTCAGGCCC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGCCGTATGAGGAGATCAAAAGGGATAATGCCTTCTTCATCAAGTACTACCAACTGCAGA 120

                          |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| silico     121 AGATCTGCGCCACCGATGAGGAGTGGACGCAGTTCCTTGCTTCCATCAGGGACAATCTGC 180

                          ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     181 CCACTACTTTCCGTGTGACAGGATTCAAGGACGAGGCCAAAGCCCTGCTATCCATTATTG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGACGCAGCTATTCACCGAGTATGTGAGGGCGGTGGCCGAGCTGCACCAGAAGGCGCCCG 300

                          |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     301 AGGATGTGGAACGTCCGCTGTGCCTGCCGTGGTATCCAAACGGACTGGCCTACCAGCTGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACCTTACCCGCAAGGACATTCGACGCTCGGAGCCGCTCTACCGGCTGCACAACTTCCTAA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTGTGGAGACCACGGCGGGCGGCATCAGCAGGCAGGAGGCCGTATCCATGATCCCGCCAA 480

6133R-3.IR_full       481 TTGTCCTGGATGTCCGACCC 500
                          |||||||||||||||||||| silico     481 TTGTCCTGGATGTCCGACCC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143750.2  CG6133-RA (CG6133), mRNA 
0   NM_137527.2  CG15092-RA (CG15092), mRNA 
0   NM_143125.1  CG10559-RA (CG10559), mRNA 
0   NM_133158.2  CG12204-RA (CG12204), mRNA 
0   NM_140897.2  CG8103-RA, transcript variant A (Mi-2), mRNA 
0   NM_001014591.1  CG8103-RB, transcript variant B (Mi-2), mRNA 
0   NM_135240.2  CG10158-RA (CG10158), mRNA 
0   NM_140906.1  CG14182-RA (CG14182), mRNA 
0   NM_140883.1  CG8780-RA (tey), mRNA 
0   NM_169936.1  CG5670-RA, transcript variant A (Atpalpha), mRNA 
0   NM_206528.1  CG5670-RE, transcript variant E (Atpalpha), mRNA 
0   NM_169937.1  CG5670-RB, transcript variant B (Atpalpha), mRNA 
0   NM_206525.1  CG5670-RH, transcript variant H (Atpalpha), mRNA 
0   NM_169939.1  CG5670-RD, transcript variant D (Atpalpha), mRNA 
0   NM_206527.1  CG5670-RF, transcript variant F (Atpalpha), mRNA 
0   NM_169938.1  CG5670-RC, transcript variant C (Atpalpha), mRNA 
0   NM_206526.1  CG5670-RG, transcript variant G (Atpalpha), mRNA 
0   NM_132184.1  CG15327-RA (CG15327), mRNA 
0   NM_132522.2  CG32662-RA (CG32662), mRNA 
0   NM_132294.2  CG32707-RA (APC4), mRNA 
0   NM_080367.2  CG3189-RA (Dpit47), mRNA 
0   NM_205948.1  CG15828-RB, transcript variant B (CG15828), mRNA 
0   NM_135460.1  CG15828-RA, transcript variant A (CG15828), mRNA 
0   NM_078666.2  CG8146-RA (Socs16D), mRNA 
0   NM_141189.1  CG14640-RA (CG14640), mRNA 
0   NM_136593.1  CG8181-RA (CG8181), mRNA 
0   NM_168495.1  CG32100-RA (CG32100), mRNA 
0   NM_001014751.1  CG33542-RA (upd3), mRNA 
0   NM_170110.2  CG5405-RC, transcript variant C (KrT95D), mRNA 
0   NM_170108.2  CG5405-RB, transcript variant B (KrT95D), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.