National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6133R-2 
 Symbol CG6133  Full Name CG6133 
 CG No CG6133  Old CG No CG6133 
 Synonyms EG:EG0007.9, CG6133 
 Accession No (Link to NCBI) NM_143750.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGCGGCTCGCAAACGTCAAA 
 Primer Seq. 3'
aatctagaggtaccGGGTCGGACATCCAGGACAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGCGGCTCG CAAACGTCAA AAGCGGGAGA ATGGTCCCAA GCGCACCGAT CGTCAGGCCC 
0061 AGCCGTATGA GGAGATCAAA AGGGATAATG CCTTCTTCAT CAAGTACTAC CAACTGCAGA 
0121 AGATCTGCGC CACCGATGAG GAGTGGACGC AGTTCCTTGC GTCCATCAGG GACAATCTGC 
0181 CCACTACTTT CCGTGTGACA GGATTTAAGG ACGAGGCCAA AGCCCTGCTA TCCATTATTG 
0241 AGACGCAGCT ATTCACCGAG TATGTGAGGG CGGTGGCCGA GCTGCACCAG AAGGCGCCCG 
0301 AGGATGTGGA ACGTCCGCTG TGCCTGCCCT GGTATCCAAA CGGACTGGCC TACCAGCTGC 
0361 ACCTTACCCG CAAGGACATT CGACGCTCGG AGCCGCTCTA CCGGCTGCAC AACTTCCTAA 
0421 TTGTGGAGAC CACGGCGGGC GGCATCAGCA GGCAGGAGGC CGTATCCATG ATCCCGCCAA 
0481 TTGTCCTGGA TGTCCGACCC  
 in silico PCR Fragment
0001 TCGCGGCTCG CAAACGTCAA AAGCGGGAGA ATGGTCCCAA GCGCACCGAT CGTCAGGCCC 
0061 AGCCGTATGA GGAGATCAAA AGGGATAATG CCTTCTTCAT CAAGTACTAC CAACTGCAGA 
0121 AGATCTGCGC CACCGATGAG GAGTGGACGC AGTTCCTTGC TTCCATCAGG GACAATCTGC 
0181 CCACTACTTT CCGTGTGACA GGATTCAAGG ACGAGGCCAA AGCCCTGCTA TCCATTATTG 
0241 AGACGCAGCT ATTCACCGAG TATGTGAGGG CGGTGGCCGA GCTGCACCAG AAGGCGCCCG 
0301 AGGATGTGGA ACGTCCGCTG TGCCTGCCGT GGTATCCAAA CGGACTGGCC TACCAGCTGC 
0361 ACCTTACCCG CAAGGACATT CGACGCTCGG AGCCGCTCTA CCGGCTGCAC AACTTCCTAA 
0421 TTGTGGAGAC CACGGCGGGC GGCATCAGCA GGCAGGAGGC CGTATCCATG ATCCCGCCAA 
0481 TTGTCCTGGA TGTCCGACCC  
 Assemble Data

6133R-2.IR_full       1   TCGCGGCTCGCAAACGTCAAAAGCGGGAGAATGGTCCCAAGCGCACCGATCGTCAGGCCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6133R-2.in silico     1   TCGCGGCTCGCAAACGTCAAAAGCGGGAGAATGGTCCCAAGCGCACCGATCGTCAGGCCC 60


6133R-2.IR_full       61  AGCCGTATGAGGAGATCAAAAGGGATAATGCCTTCTTCATCAAGTACTACCAACTGCAGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6133R-2.in silico     61  AGCCGTATGAGGAGATCAAAAGGGATAATGCCTTCTTCATCAAGTACTACCAACTGCAGA 120


6133R-2.IR_full       121 AGATCTGCGCCACCGATGAGGAGTGGACGCAGTTCCTTGCGTCCATCAGGGACAATCTGC 180
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
6133R-2.in silico     121 AGATCTGCGCCACCGATGAGGAGTGGACGCAGTTCCTTGCTTCCATCAGGGACAATCTGC 180


6133R-2.IR_full       181 CCACTACTTTCCGTGTGACAGGATTTAAGGACGAGGCCAAAGCCCTGCTATCCATTATTG 240
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
6133R-2.in silico     181 CCACTACTTTCCGTGTGACAGGATTCAAGGACGAGGCCAAAGCCCTGCTATCCATTATTG 240


6133R-2.IR_full       241 AGACGCAGCTATTCACCGAGTATGTGAGGGCGGTGGCCGAGCTGCACCAGAAGGCGCCCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6133R-2.in silico     241 AGACGCAGCTATTCACCGAGTATGTGAGGGCGGTGGCCGAGCTGCACCAGAAGGCGCCCG 300


6133R-2.IR_full       301 AGGATGTGGAACGTCCGCTGTGCCTGCCCTGGTATCCAAACGGACTGGCCTACCAGCTGC 360
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
6133R-2.in silico     301 AGGATGTGGAACGTCCGCTGTGCCTGCCGTGGTATCCAAACGGACTGGCCTACCAGCTGC 360


6133R-2.IR_full       361 ACCTTACCCGCAAGGACATTCGACGCTCGGAGCCGCTCTACCGGCTGCACAACTTCCTAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6133R-2.in silico     361 ACCTTACCCGCAAGGACATTCGACGCTCGGAGCCGCTCTACCGGCTGCACAACTTCCTAA 420


6133R-2.IR_full       421 TTGTGGAGACCACGGCGGGCGGCATCAGCAGGCAGGAGGCCGTATCCATGATCCCGCCAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6133R-2.in silico     421 TTGTGGAGACCACGGCGGGCGGCATCAGCAGGCAGGAGGCCGTATCCATGATCCCGCCAA 480


6133R-2.IR_full       481 TTGTCCTGGATGTCCGACCC 500
                          ||||||||||||||||||||
6133R-2.in silico     481 TTGTCCTGGATGTCCGACCC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143750.2  CG6133-RA (CG6133), mRNA 
0   NM_137527.2  CG15092-RA (CG15092), mRNA 
0   NM_143125.1  CG10559-RA (CG10559), mRNA 
0   NM_133158.2  CG12204-RA (CG12204), mRNA 
0   NM_140897.2  CG8103-RA, transcript variant A (Mi-2), mRNA 
0   NM_001014591.1  CG8103-RB, transcript variant B (Mi-2), mRNA 
0   NM_135240.2  CG10158-RA (CG10158), mRNA 
0   NM_140906.1  CG14182-RA (CG14182), mRNA 
0   NM_140883.1  CG8780-RA (tey), mRNA 
0   NM_169936.1  CG5670-RA, transcript variant A (Atpalpha), mRNA 
0   NM_206528.1  CG5670-RE, transcript variant E (Atpalpha), mRNA 
0   NM_169937.1  CG5670-RB, transcript variant B (Atpalpha), mRNA 
0   NM_206525.1  CG5670-RH, transcript variant H (Atpalpha), mRNA 
0   NM_169939.1  CG5670-RD, transcript variant D (Atpalpha), mRNA 
0   NM_206527.1  CG5670-RF, transcript variant F (Atpalpha), mRNA 
0   NM_169938.1  CG5670-RC, transcript variant C (Atpalpha), mRNA 
0   NM_206526.1  CG5670-RG, transcript variant G (Atpalpha), mRNA 
0   NM_132184.1  CG15327-RA (CG15327), mRNA 
0   NM_132522.2  CG32662-RA (CG32662), mRNA 
0   NM_132294.2  CG32707-RA (APC4), mRNA 
0   NM_080367.2  CG3189-RA (Dpit47), mRNA 
0   NM_205948.1  CG15828-RB, transcript variant B (CG15828), mRNA 
0   NM_135460.1  CG15828-RA, transcript variant A (CG15828), mRNA 
0   NM_078666.2  CG8146-RA (Socs16D), mRNA 
0   NM_141189.1  CG14640-RA (CG14640), mRNA 
0   NM_136593.1  CG8181-RA (CG8181), mRNA 
0   NM_168495.1  CG32100-RA (CG32100), mRNA 
0   NM_001014751.1  CG33542-RA (upd3), mRNA 
0   NM_170110.2  CG5405-RC, transcript variant C (KrT95D), mRNA 
0   NM_170108.2  CG5405-RB, transcript variant B (KrT95D), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.