National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6121R-1 
 Symbol Tip60  Full Name Tip60 
 CG No CG6121  Old CG No CG6121 
 Synonyms CG6121, dTip60, dmHAG405, EG0007.7, DmEG0007.7, EG:EG0007.7, Tip60, dTIP60, Dmel/TIP60, Dmel?TIP60 
 Accession No (Link to NCBI) NM_131923.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCACAAAACGGACGACTGG 
 Primer Seq. 3'
aatctagaggtaccTGTGACTGCTGCTGTTGACTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCACAAAA CGGACGACTG GCCACTANCG GAGATTGTGA GCATCAAGGA GTTGGATGGG 
0061 CGCCGGCAGT TTTACGTGCA CTATGTGGAC TTCAACAAGC GCTTGGACGA GTGGGTCAAC 
0121 GAGGAGGATC TGTACACGCG AAAGGTGCAA TTTCCGCGGA GAGACGGCTC ACAAACAGGC 
0181 ACCAGCACTG GAGTGACCAC GCCACAGCGC CACCATTCCC TAGCGGGCAG CNTTTCTCGG 
0241 CCTACATCAC CGCAACACCC TGGTTCCGGG GCTCTGGCAG CCATCCCCCA GACTCCTACT 
0301 GGTGCATCAG GCAGTGTTCC TCCCCCTGCT GGCATTCCAA ACTCTGTGGC TCCACCCGGA 
0361 ACACCAAGCA GTGGGGGAGA GCTTGTGAAT GGCAACAATC TGGCCGCAGC CCTTCAGAAA 
0421 CGCATCAATC GCAAGCGAAA AAACCACGGA GGCTCGGCCC ATGGACACCA CAGTCTGACC 
0481 AGTCAACAGC AGCAGTCACA  
 in silico PCR Fragment
0001 ATGCACAAAA CGGACGACTG GCCACTAGCG GAGATTGTGA GCATCAAGGA GTTGGATGGG 
0061 CGCCGGCAGT TTTACGTGCA CTATGTGGAC TTCAACAAGC GCTTGGACGA GTGGGTCAAC 
0121 GAGGAGGATC TGTACACGCG AAAGGTGCAA TTTCCGCGGA GAGACGGCTC ACAAACAGGC 
0181 ACCAGCACTG GAGTGACCAC GCCACAGCGC CACCATTCCC TAGCGGGCAG CGTTTCTCGG 
0241 CCTACATCAC CGCAACACCC TGGTTCCGGG GCTCTGGCAG CCATCCCCCA GACTCCTACT 
0301 GGTGCATCAG GCAGTGTTCC TCCCCCTGCT GGCATTCCAA ACTCTGTGGC TCCACCCGGA 
0361 ACACCAAGCA GTGGGGGAGA GCTTGTGAAT GGCAACAATC TGGCCGCAGC CCTTCAGAAA 
0421 CGCATCAATC GCAAGCGAAA AAACCACGGA GGCTCGGCCC ATGGACACCA CAGTCTGACC 
0481 AGTCAACAGC AGCAGTCACA  
 Assemble Data

6121R-1.IR_full       1   ATGCACAAAACGGACGACTGGCCACTANCGGAGATTGTGAGCATCAAGGAGTTGGATGGG 60
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
6121R-1.in silico     1   ATGCACAAAACGGACGACTGGCCACTAGCGGAGATTGTGAGCATCAAGGAGTTGGATGGG 60


6121R-1.IR_full       61  CGCCGGCAGTTTTACGTGCACTATGTGGACTTCAACAAGCGCTTGGACGAGTGGGTCAAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6121R-1.in silico     61  CGCCGGCAGTTTTACGTGCACTATGTGGACTTCAACAAGCGCTTGGACGAGTGGGTCAAC 120


6121R-1.IR_full       121 GAGGAGGATCTGTACACGCGAAAGGTGCAATTTCCGCGGAGAGACGGCTCACAAACAGGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6121R-1.in silico     121 GAGGAGGATCTGTACACGCGAAAGGTGCAATTTCCGCGGAGAGACGGCTCACAAACAGGC 180


6121R-1.IR_full       181 ACCAGCACTGGAGTGACCACGCCACAGCGCCACCATTCCCTAGCGGGCAGCNTTTCTCGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
6121R-1.in silico     181 ACCAGCACTGGAGTGACCACGCCACAGCGCCACCATTCCCTAGCGGGCAGCGTTTCTCGG 240


6121R-1.IR_full       241 CCTACATCACCGCAACACCCTGGTTCCGGGGCTCTGGCAGCCATCCCCCAGACTCCTACT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6121R-1.in silico     241 CCTACATCACCGCAACACCCTGGTTCCGGGGCTCTGGCAGCCATCCCCCAGACTCCTACT 300


6121R-1.IR_full       301 GGTGCATCAGGCAGTGTTCCTCCCCCTGCTGGCATTCCAAACTCTGTGGCTCCACCCGGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6121R-1.in silico     301 GGTGCATCAGGCAGTGTTCCTCCCCCTGCTGGCATTCCAAACTCTGTGGCTCCACCCGGA 360


6121R-1.IR_full       361 ACACCAAGCAGTGGGGGAGAGCTTGTGAATGGCAACAATCTGGCCGCAGCCCTTCAGAAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6121R-1.in silico     361 ACACCAAGCAGTGGGGGAGAGCTTGTGAATGGCAACAATCTGGCCGCAGCCCTTCAGAAA 420


6121R-1.IR_full       421 CGCATCAATCGCAAGCGAAAAAACCACGGAGGCTCGGCCCATGGACACCACAGTCTGACC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6121R-1.in silico     421 CGCATCAATCGCAAGCGAAAAAACCACGGAGGCTCGGCCCATGGACACCACAGTCTGACC 480


6121R-1.IR_full       481 AGTCAACAGCAGCAGTCACA 500
                          ||||||||||||||||||||
6121R-1.in silico     481 AGTCAACAGCAGCAGTCACA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_131923.2  CG6121-RA (Tip60), mRNA 
0   NM_134559.1  CG1829-RA (Cyp6v1), mRNA 
0   NM_079832.2  CG7887-RA (Takr99D), mRNA 
0   NM_132476.2  CG1657-RA (CG1657), mRNA 
0   NM_078805.3  CG5838-RA (Dref), mRNA 
0   NM_079091.2  CG12781-RA, transcript variant A (nahoda), mRNA 
0   NM_166569.1  CG12781-RB, transcript variant B (nahoda), mRNA 
0   NM_057972.3  CG2917-RA (Orc4), mRNA 
0   NM_137420.2  CG5009-RA (CG5009), mRNA 
0   NM_143288.2  CG31064-RE, transcript variant E (CG31064), mRNA 
0   NM_170325.1  CG31064-RA, transcript variant A (CG31064), mRNA 
0   NM_170324.1  CG31064-RB, transcript variant B (CG31064), mRNA 
0   NM_132074.1  CG3585-RA (CG3585), mRNA 
0   NM_134567.2  CG1314-RA (CG1314), mRNA 
0   16  NM_136332.2  CG8426-RA (l(2)NC136), mRNA 
0   NM_080097.2  CG6699-RA (beta'Cop), mRNA 
0   NM_166195.1  CG5522-RE, transcript variant E (CG5522), mRNA 
0   NM_137314.2  CG5522-RC, transcript variant C (CG5522), mRNA 
0   NM_166194.1  CG5522-RB, transcript variant B (CG5522), mRNA 
0   NM_166193.1  CG5522-RA, transcript variant A (CG5522), mRNA 
0   NM_166197.1  CG5522-RF, transcript variant F (CG5522), mRNA 
0   NM_166196.1  CG5522-RD, transcript variant D (CG5522), mRNA 
0   NM_137687.2  CG15651-RA (CG15651), mRNA 
0   NM_057261.2  CG3821-RA (Aats-asp), mRNA 
0   NM_166616.1  CG5411-RA, transcript variant A (Pde8), mRNA 
0   NM_137970.3  CG5411-RE, transcript variant E (Pde8), mRNA 
0   NM_166618.1  CG5411-RB, transcript variant B (Pde8), mRNA 
0   NM_166617.1  CG5411-RD, transcript variant D (Pde8), mRNA 
0   NM_169350.1  CG4067-RB, transcript variant B (pug), mRNA 
0   NM_001014614.1  CG4067-RD, transcript variant D (pug), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
++ 
DM
+- 
VM
+- 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
++ 
VM
VB
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.