National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6118R-2 
 Symbol CG6118  Full Name CG6118 
 CG No CG6118  Old CG No CG6118 
 Synonyms CG6118 
 Accession No (Link to NCBI) NM_001104335 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCAAGATGTCCGAGGAGCCC 
 Primer Seq. 3'
aatctagaggtaccTGTTGCTGCTGCTGCTGCTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATCAAGATGT CCGAGGAGCC CAAGCGACGC GAGTGGCCCT TCTTCACCCT GATGGACGTG 
0061 TACTTCAGCG ACCAGGTTAA CGATCCCTCG CTGCGTCTCT TCTCGTCCAC AAAGACGCTC 
0121 AAGGAGACCC TGGACGACAG CGTCTTCGAG GATGATCCAA TTATCGCCTC GGCCATTGCG 
0181 gcCGCCACCA GTGGCGCCTA CATGGACATT GATGAGCTCA TCCGGCGACA GAAGGAGcGT 
0241 GCCGCTCTGG CCGCCGAGCG GAAATTGGCT GCTGCTGCCA GCGGAGGCAC TGGTGACTAC 
0301 AAATTCGATC TGAAGCCCAT GCTATCGAAC AGCAAGTTTA ACAGCAACAG CGAGGATGGC 
0361 CAAGCTATCA AAGAGCGTCG ATGACCTCTC TATGCAGCAG TACAAGATCA AGCAAGAGCT 
0421 AATGCGCCAG CGGGAACAGG AGCAGCAGGA GAACATGGTC AAGATCAAGC AGCACGTACG 
0481 CCCAGCAGCA GCAGCAGCAA CA 
 in silico PCR Fragment
0001 ATCAAGATGT CCGAGGAGCC CAAGCGACGC GAGTGGCCCT TCTTCACCCT GATGGACGTG 
0061 TACTTCAGCG ACCAGGTTAA CGATCCCTCA CTACGTCTCT TCTCGTCCAC AAAGACGCTC 
0121 AAGGAGACCC TGGACGACAG CGTCTTCGAG GATGATCCAA TTATCGCCTC GGCCATTGCG 
0181 GCGGCCACCA GTGGCGCCTA CATGGACATT GATGAGCTCA TCCGGCGACA GAAGGAGCGT 
0241 GCCGCTCTGG CCGCCGAGCG GAAATTGGCT GCCGCTGCCA GCGGAGGCAC TGGTGACTAC 
0301 AAATTCGATC TGAAGCCCAT GCTATCGAAC AGCAAGTTTA ACAGCAACAG CGA-GATGGC 
0361 CAAGCTATCA AAGAGCGTCG ATGACCTCTC TATGCAGCAG TACAAGATCA AGCAAGAGCT 
0421 AATGCGCCAG CGGGAACAGG AGCAGCAGGA GAACATGGTC AAGATCAAGC AGCACGTACG 
0481 -CCAGCAGCA GCAGCAGCAA CA 
 Assemble Data

6118R-2.IR_full       1   ATCAAGATGTCCGAGGAGCCCAAGCGACGCGAGTGGCCCTTCTTCACCCTGATGGACGTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6118R-2.in silico     1   ATCAAGATGTCCGAGGAGCCCAAGCGACGCGAGTGGCCCTTCTTCACCCTGATGGACGTG 60


6118R-2.IR_full       61  TACTTCAGCGACCAGGTTAACGATCCCTCGCTGCGTCTCTTCTCGTCCACAAAGACGCTC 120
                          ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||
6118R-2.in silico     61  TACTTCAGCGACCAGGTTAACGATCCCTCACTACGTCTCTTCTCGTCCACAAAGACGCTC 120


6118R-2.IR_full       121 AAGGAGACCCTGGACGACAGCGTCTTCGAGGATGATCCAATTATCGCCTCGGCCATTGCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6118R-2.in silico     121 AAGGAGACCCTGGACGACAGCGTCTTCGAGGATGATCCAATTATCGCCTCGGCCATTGCG 180


6118R-2.IR_full       181 GCCGCCACCAGTGGCGCCTACATGGACATTGATGAGCTCATCCGGCGACAGAAGGAGCGT 240
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6118R-2.in silico     181 GCGGCCACCAGTGGCGCCTACATGGACATTGATGAGCTCATCCGGCGACAGAAGGAGCGT 240


6118R-2.IR_full       241 GCCGCTCTGGCCGCCGAGCGGAAATTGGCTGCTGCTGCCAGCGGAGGCACTGGTGACTAC 300
                          |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
6118R-2.in silico     241 GCCGCTCTGGCCGCCGAGCGGAAATTGGCTGCCGCTGCCAGCGGAGGCACTGGTGACTAC 300


6118R-2.IR_full       301 AAATTCGATCTGAAGCCCATGCTATCGAACAGCAAGTTTAACAGCAACAGCGAGGATGGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
6118R-2.in silico     301 AAATTCGATCTGAAGCCCATGCTATCGAACAGCAAGTTTAACAGCAACAGCGA-GATGGC 360


6118R-2.IR_full       361 CAAGCTATCAAAGAGCGTCGATGACCTCTCTATGCAGCAGTACAAGATCAAGCAAGAGCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6118R-2.in silico     361 CAAGCTATCAAAGAGCGTCGATGACCTCTCTATGCAGCAGTACAAGATCAAGCAAGAGCT 420


6118R-2.IR_full       421 AATGCGCCAGCGGGAACAGGAGCAGCAGGAGAACATGGTCAAGATCAAGCAGCACGTACG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6118R-2.in silico     421 AATGCGCCAGCGGGAACAGGAGCAGCAGGAGAACATGGTCAAGATCAAGCAGCACGTACG 480


6118R-2.IR_full       481 CCCAGCAGCAGCAGCAGCAACA 502
                           |||||||||||||||||||||
6118R-2.in silico     481 -CCAGCAGCAGCAGCAGCAACA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.62  485  11  28  75  NM_142210.1  CG6118-RA (CG6118), mRNA 
5.8   28  135  322  587  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
5.8   28  135  322  587  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
5.8   28  135  322  587  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
2.07   10  29  93  189  NM_079903.2  CG15319-RB (nej), mRNA 
1.86   34  117  260  NM_001038734.1  CG16902-RC (Hr4), mRNA 
1.86   30  94  180  NM_168571.2  CG32133-RA (CG32133), mRNA 
1.65   47  139  315  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
1.65   47  139  315  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
1.65   21  55  102  NM_206456.1  CG32466-RB, transcript variant B (rn), mRNA 
1.65   20  61  132  NM_078514.2  CG9653-RA (brk), mRNA 
1.65   17  42  76  NM_001043134.1  CG7368-RB (CG7368), mRNA 
1.65   17  37  61  NM_141458.2  CG32466-RA, transcript variant A (rn), mRNA 
1.45   22  71  141  NM_166874.1  CG3638-RA, transcript variant A (CG3638), mRNA 
1.45   22  71  141  NM_130541.3  CG3638-RC, transcript variant C (CG3638), mRNA 
1.45   22  71  141  NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 
1.45   22  71  141  NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
1.45   21  69  144  NM_057497.3  CG5058-RD, transcript variant D (grh), mRNA 
1.45   21  69  144  NM_057496.3  CG5058-RC, transcript variant C (grh), mRNA 
1.24   32  93  190  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
1.24   29  69  133  NM_134474.4  CG32532-RA (CG32532), mRNA 
1.24   28  78  146  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
1.24   26  54  86  NM_132569.1  CG11245-RA (CG11245), mRNA 
1.24   24  68  124  NM_137212.2  CG30089-RA (CG30089), mRNA 
1.24   24  52  70  NM_167239.2  CG32677-RA (CG32677), mRNA 
1.24   20  65  133  NM_167000.1  CG32778-RA (CG32778), mRNA 
1.24   18  87  180  NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
1.24   18  81  172  NM_001042894.1  CG5461-RF, transcript variant F (bun), mRNA 
1.24   15  45  83  NM_168461.2  CG11711-RA, transcript variant A (Mob1), mRNA 
1.24   12  86  210  NM_139493.2  CG2083-RA (CG2083), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.