National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6118R-1 
 Symbol CG6118  Full Name CG6118 
 CG No CG6118  Old CG No CG6118 
 Synonyms CG6118 
 Accession No (Link to NCBI) NM_001104335 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATCAAGATGTCCGAGGAGCCCAAGCGACGCGAGTGGCCCTTCTTCACCCTGATGGACGTG 60

                          ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| silico     61  TACTTCAGCGACCAGGTTAACGATCCCTCACTACGTCTCTTCTCGTCCACAAAGACGCTC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAGGAGACCCTGGACGACAGCGTCTTCGAGGATGATCCAATTATCGCCTCGGCCATTGCG 180

                          || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCGGCCACCAGTGGCGCCTACATGGACATTGATGAGCTCATCCGGCGACAGAAGGAGCGT 240

                          |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     241 GCCGCTCTGGCCGCCGAGCGGAAATTGGCTGCCGCTGCCAGCGGAGGCACTGGTGACTAC 300

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| silico     301 AAATTCGATCTGAAGCCCATGCTATCGAACAGCAAGTTTAACAGCAACAGCGA-GATGGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAAGCTATCAAAGAGCGTCGATGACCTCTCTATGCAGCAGTACAAGATCAAGCAAGAGCT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AATGCGCCAGCGGGAACAGGAGCAGCAGGAGAACATGGTCAAGATCAAGCAGCACGTACG 480

6118R-1.IR_full       481 CCCAGCAGCAGCAGCAGCAACA 502
                           ||||||||||||||||||||| silico     481 -CCAGCAGCAGCAGCAGCAACA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.62  485  11  28  75  NM_142210.1  CG6118-RA (CG6118), mRNA 
5.8   28  135  322  587  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
5.8   28  135  322  587  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
5.8   28  135  322  587  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
2.07   10  29  93  189  NM_079903.2  CG15319-RB (nej), mRNA 
1.86   34  117  260  NM_001038734.1  CG16902-RC (Hr4), mRNA 
1.86   30  94  180  NM_168571.2  CG32133-RA (CG32133), mRNA 
1.65   47  139  315  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
1.65   47  139  315  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
1.65   21  55  102  NM_206456.1  CG32466-RB, transcript variant B (rn), mRNA 
1.65   20  61  132  NM_078514.2  CG9653-RA (brk), mRNA 
1.65   17  42  76  NM_001043134.1  CG7368-RB (CG7368), mRNA 
1.65   17  37  61  NM_141458.2  CG32466-RA, transcript variant A (rn), mRNA 
1.45   22  71  141  NM_166874.1  CG3638-RA, transcript variant A (CG3638), mRNA 
1.45   22  71  141  NM_130541.3  CG3638-RC, transcript variant C (CG3638), mRNA 
1.45   22  71  141  NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 
1.45   22  71  141  NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
1.45   21  69  144  NM_057497.3  CG5058-RD, transcript variant D (grh), mRNA 
1.45   21  69  144  NM_057496.3  CG5058-RC, transcript variant C (grh), mRNA 
1.24   32  93  190  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
1.24   29  69  133  NM_134474.4  CG32532-RA (CG32532), mRNA 
1.24   28  78  146  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
1.24   26  54  86  NM_132569.1  CG11245-RA (CG11245), mRNA 
1.24   24  68  124  NM_137212.2  CG30089-RA (CG30089), mRNA 
1.24   24  52  70  NM_167239.2  CG32677-RA (CG32677), mRNA 
1.24   20  65  133  NM_167000.1  CG32778-RA (CG32778), mRNA 
1.24   18  87  180  NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
1.24   18  81  172  NM_001042894.1  CG5461-RF, transcript variant F (bun), mRNA 
1.24   15  45  83  NM_168461.2  CG11711-RA, transcript variant A (Mob1), mRNA 
1.24   12  86  210  NM_139493.2  CG2083-RA (CG2083), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.